ID: 916524733

View in Genome Browser
Species Human (GRCh38)
Location 1:165598743-165598765
Sequence TTGTAGGTTCAGGGAAGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916524727_916524733 24 Left 916524727 1:165598696-165598718 CCTGGGTGGGGACAGTTGCAGCA No data
Right 916524733 1:165598743-165598765 TTGTAGGTTCAGGGAAGGCGTGG No data
916524726_916524733 25 Left 916524726 1:165598695-165598717 CCCTGGGTGGGGACAGTTGCAGC No data
Right 916524733 1:165598743-165598765 TTGTAGGTTCAGGGAAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916524733 Original CRISPR TTGTAGGTTCAGGGAAGGCG TGG Intergenic
No off target data available for this crispr