ID: 916526782

View in Genome Browser
Species Human (GRCh38)
Location 1:165617846-165617868
Sequence CACATAAGAATGCAGCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916526777_916526782 19 Left 916526777 1:165617804-165617826 CCTTATAAAAGAGGCTTGAGGGA 0: 24
1: 77
2: 242
3: 596
4: 1262
Right 916526782 1:165617846-165617868 CACATAAGAATGCAGCAGCAAGG No data
916526775_916526782 20 Left 916526775 1:165617803-165617825 CCCTTATAAAAGAGGCTTGAGGG No data
Right 916526782 1:165617846-165617868 CACATAAGAATGCAGCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916526782 Original CRISPR CACATAAGAATGCAGCAGCA AGG Intergenic
No off target data available for this crispr