ID: 916527883

View in Genome Browser
Species Human (GRCh38)
Location 1:165628825-165628847
Sequence TCCCTATGTGGAGGGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 613
Summary {0: 1, 1: 21, 2: 40, 3: 43, 4: 508}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916527879_916527883 8 Left 916527879 1:165628794-165628816 CCATAAAACAAAGGAAAATTTGT 0: 26
1: 17
2: 18
3: 83
4: 931
Right 916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG 0: 1
1: 21
2: 40
3: 43
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916527883 Original CRISPR TCCCTATGTGGAGGGAGTGC TGG Intergenic
900797158 1:4715071-4715093 TCCCCAGATGGAAGGAGTGCTGG + Intronic
901148457 1:7084432-7084454 TCCTTCTGGGGAGGGAGTGGGGG + Intronic
901582837 1:10259756-10259778 TCCCAAAGTGCAGGGATTGCAGG + Intronic
901938748 1:12645800-12645822 TCCCAAAGTGTAGGGATTGCAGG + Intronic
902369990 1:16000004-16000026 TCCCAATGTGCTGGGACTGCAGG + Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902734682 1:18392333-18392355 TCCCAAAGTGGAGGGATTACAGG - Intergenic
902837194 1:19054693-19054715 TGCCCATGAGGAGGGACTGCTGG + Intergenic
903402302 1:23063838-23063860 TCCTTATGGGGTGGGAGTGGGGG + Intronic
903414263 1:23170820-23170842 TCCCAAAGTGGTGGGATTGCAGG - Intronic
903650458 1:24918717-24918739 ACCCTATGAGCAGGGAGTTCTGG - Intronic
904252471 1:29235079-29235101 TCCCAATGTGCAGGGATTACAGG - Intergenic
905142553 1:35859626-35859648 TCCCTATGTGCTGGGATTACAGG + Intergenic
905210810 1:36372933-36372955 TGCCTTTGTGGATGGAGAGCAGG - Intronic
905485784 1:38295350-38295372 TCAAAATGTGGAGGGAGGGCAGG - Intergenic
905858779 1:41332339-41332361 TCCCAAAGTGCTGGGAGTGCAGG - Intergenic
906351243 1:45061830-45061852 TCCCAAAGTGCTGGGAGTGCAGG - Intronic
907079147 1:51605330-51605352 TCCCTAAGTGCTGGGATTGCAGG - Intronic
908230460 1:62099535-62099557 TTTGTATGTGTAGGGAGTGCAGG + Intronic
908307550 1:62838517-62838539 TCCCAAAGTGGAGGGATTACAGG - Intronic
908320128 1:62970852-62970874 TCCCAAAGTGGAGGGATTACAGG - Intergenic
909791202 1:79680303-79680325 TCCCAAAGTGTTGGGAGTGCAGG - Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
910775754 1:90872939-90872961 TCCCTAAGTGGTAGGAGTACAGG + Intergenic
911960709 1:104298652-104298674 TCCCAATGTGCTGGGATTGCAGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912798354 1:112706237-112706259 TCCCTAGGTGTAGGGTGGGCCGG - Exonic
913084750 1:115426395-115426417 ACCCAATGTGCAGGGACTGCTGG + Intergenic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915089887 1:153416908-153416930 TCCCTCTGTGGGGGCAGAGCTGG - Intronic
915568663 1:156731874-156731896 GCCCTATGTGGCAGCAGTGCTGG + Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916310129 1:163388850-163388872 TCCCAAAGTGCAGGGAGTACAGG + Intergenic
916489028 1:165285230-165285252 TCCTTAGGTGGAGAGAGTTCTGG + Intronic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
916656667 1:166882784-166882806 TCCCTAAGTGGTGGGATTACAGG + Intergenic
918078865 1:181190609-181190631 ACCCTATGAGGAGGGAGGGGAGG - Intergenic
918314730 1:183313742-183313764 TCCCAATGTGCAGGGATTACAGG + Intronic
919264690 1:195247373-195247395 TCCCAATGTGGTGGGATTACAGG - Intergenic
919314277 1:195951667-195951689 TCCCAAAGTGGTGGGATTGCAGG + Intergenic
920305464 1:205015544-205015566 TCCCCTTGTGCAGGGAGAGCTGG - Intronic
921290590 1:213653198-213653220 TCCCAAAGTGGTGGGATTGCAGG - Intergenic
921452699 1:215327806-215327828 TCCCTAAGTGCTGGGATTGCAGG - Intergenic
921935852 1:220796378-220796400 TCCCTACCTGGAAGGAATGCAGG - Intronic
922806591 1:228393462-228393484 TCCTTATGTGGAGCTATTGCCGG - Intergenic
923664979 1:235991759-235991781 TCCCTGTGGGCAGGGAGTTCAGG - Intronic
923680758 1:236116659-236116681 TCCCTAAGTGCTGGGATTGCAGG + Intergenic
924044690 1:240015439-240015461 TCCCAAAGTGCAGGGAGTTCAGG - Intronic
924314215 1:242778924-242778946 TCCCGAAGTGGAGGGATTACAGG - Intergenic
924733787 1:246736441-246736463 TCCCAAAGTGCTGGGAGTGCAGG - Intronic
1062989253 10:1800160-1800182 TCCCATTGAGGAGGGAGTGAGGG + Intergenic
1064227936 10:13503969-13503991 TGCCTAGGAGGAGGGAGTCCTGG + Intronic
1064628476 10:17285401-17285423 TCCCTAGTTGCTGGGAGTGCAGG + Intergenic
1064764612 10:18658742-18658764 TCCCAAAGTGGTGGGATTGCAGG - Intergenic
1064797824 10:19033510-19033532 TCCCAATGTGCTGGGATTGCAGG - Intergenic
1065097470 10:22295953-22295975 TCCCAATGTGCTGGGATTGCAGG + Intergenic
1065262904 10:23944164-23944186 TCCCTAAGTGCTGGGATTGCAGG - Intronic
1065754311 10:28917067-28917089 TCCCAAAGTGTAGGGATTGCAGG - Intergenic
1065936313 10:30523458-30523480 TCCCAAAGTGGTGGGAGTACAGG + Intergenic
1066193761 10:33079122-33079144 TCCCTAAGTGCTGGGATTGCAGG + Intergenic
1066458134 10:35589471-35589493 TCCCTAAGTGTTGGGATTGCAGG + Intergenic
1068389132 10:56370462-56370484 TCCTAATGTTAAGGGAGTGCTGG - Intergenic
1068441210 10:57057166-57057188 TCCCAAAGTGCTGGGAGTGCAGG - Intergenic
1069010327 10:63364743-63364765 TCCCTAAGTGCTGGGAGTACAGG + Intronic
1069472641 10:68706560-68706582 TCCCAATGTGCTGGGATTGCAGG - Intergenic
1069544415 10:69318569-69318591 TCCCTACGTGGGGGACGTGCAGG + Intronic
1069787427 10:70997824-70997846 TCTCCATGTGGTGGGAGAGCTGG + Intergenic
1070255741 10:74811938-74811960 TCCCAAAGTGCAGGGATTGCAGG - Intergenic
1070482831 10:76902049-76902071 TCCTTATGTGATGGGAGTGAGGG + Intronic
1073205870 10:101769053-101769075 GCCGTATGTGGAGGGAGGGAGGG - Intergenic
1073334410 10:102694975-102694997 TCCCAAAGTGTTGGGAGTGCGGG + Intronic
1073961005 10:108928299-108928321 ACCCTATGTGGAGCAACTGCAGG - Intergenic
1074529475 10:114287437-114287459 TCCCAAAGTGGAGGGATTACAGG + Intronic
1074975332 10:118576529-118576551 TCCCCATCTGCTGGGAGTGCTGG + Intergenic
1075090308 10:119440807-119440829 TCCCTATGTGCTGGGATTACAGG + Intronic
1075123938 10:119684476-119684498 TCCCAATGTGCCGGGATTGCAGG + Intergenic
1075982993 10:126757257-126757279 TCCCAAAGTGCAGGGATTGCAGG - Intergenic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1079101006 11:17542458-17542480 TCCCTGTGTGCAGGCAGGGCAGG - Intronic
1079816964 11:25073398-25073420 TCCCTGTGTGGAGGAAGTGCTGG + Intronic
1080543087 11:33288192-33288214 TCCCTAAGTGCAGGGATTACAGG - Intronic
1080964342 11:37196561-37196583 ACCCTTTGTGGAGGCAGTGAGGG - Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081196256 11:40164493-40164515 TCCCAATGTGCAGGGATTACAGG + Intronic
1081913462 11:46715963-46715985 TCCCAAAGTGGTGGGATTGCAGG + Intergenic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1083357932 11:62081328-62081350 TCCCTAAGTGCTGGGATTGCAGG + Intergenic
1083421998 11:62558889-62558911 TCCCAAAGTGGTGGGATTGCAGG - Intergenic
1084307349 11:68295711-68295733 TCCCAAAGTGGAGGGATTACAGG - Intergenic
1084661762 11:70550311-70550333 TCCCTACCTGGAGGGTGGGCAGG + Intronic
1084905663 11:72344468-72344490 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1085167586 11:74417004-74417026 TCCCAATGTGCTGGGATTGCAGG - Intergenic
1085309659 11:75508765-75508787 GCCCTATGTGGGGGGAGTAGGGG - Intronic
1086536007 11:87847613-87847635 TCCCTGTGTGGAGTGAGTAGGGG + Intergenic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1088273484 11:108059618-108059640 TCCCTAAGTGCTGGGATTGCAGG - Intronic
1088595268 11:111436365-111436387 TCCCAAAGTGCTGGGAGTGCTGG - Intronic
1089804215 11:121068623-121068645 TCCCTAAGTGGTGGGATTACAGG - Intronic
1090780128 11:130000846-130000868 TCCCTAAGTGCTGGGATTGCAGG - Intronic
1091458101 12:623204-623226 TCACTGTCAGGAGGGAGTGCTGG - Intronic
1092342454 12:7688384-7688406 TCCCAAAGTGCTGGGAGTGCAGG - Intergenic
1092611839 12:10181063-10181085 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1092983746 12:13824594-13824616 TCCCAAAGTGGAGGGATTACAGG - Intronic
1093722458 12:22460835-22460857 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1094144269 12:27212524-27212546 TCCCTAAGTGCTGGGATTGCAGG - Intergenic
1095267258 12:40174835-40174857 TCCCAAAGTGCAGGGATTGCAGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096108259 12:49011818-49011840 TCCCAATGTGGTGGGATTACAGG + Intronic
1096567961 12:52496827-52496849 TCCCAGTGTGGAGGGAGGACAGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097204481 12:57308424-57308446 TCCCTAAGTGTTGGGATTGCAGG - Intronic
1097205821 12:57320005-57320027 TCCCAAAGTGGTGGGATTGCAGG - Intronic
1097542832 12:60961716-60961738 TCCCTAAGTGCTGGGATTGCAGG + Intergenic
1098122482 12:67256595-67256617 TCCCTTGGTGGAGGGAGCACAGG - Intergenic
1098170184 12:67739050-67739072 TCCCTATGTGCTGGGATTACAGG + Intergenic
1098405580 12:70122983-70123005 TCCCTCTGTGGATGGGGTGCTGG - Intergenic
1099264608 12:80429712-80429734 TCCCAAAGTGTAGGGATTGCAGG - Intronic
1100161921 12:91870767-91870789 TCCCAAAGTGCTGGGAGTGCAGG + Intergenic
1100306535 12:93355050-93355072 TCCCTATGTGCTGGGATTACAGG - Intergenic
1102922216 12:116800236-116800258 TCCCAATGTGCAGGGATTACAGG - Intronic
1103369886 12:120410920-120410942 TCCCAATGTGTAGGGATTACAGG + Intergenic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1104174323 12:126315062-126315084 GCCCTAGCTGGAAGGAGTGCTGG - Intergenic
1104623542 12:130336200-130336222 TCCCAATGTGCAGGGATTACAGG - Intergenic
1104630546 12:130397758-130397780 TCTCTGTCTCGAGGGAGTGCGGG + Exonic
1104855224 12:131898753-131898775 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1106543638 13:30712654-30712676 TCCCTAAGTGGTGGGACTACAGG + Intergenic
1106662487 13:31814504-31814526 TCCATATGTGGAAGGCGTTCTGG - Intergenic
1106685557 13:32055299-32055321 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1107333237 13:39324516-39324538 GCCCTGTGTGGACGGAGTGAGGG - Intergenic
1107637253 13:42405126-42405148 TCCCTATGTGATGGGATTACAGG + Intergenic
1107685228 13:42890554-42890576 TCCCAATGTGGTGGGATTACAGG + Intronic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1109270018 13:60245510-60245532 TCCCTATGTGAAGGGAGTAGTGG + Intergenic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1109997975 13:70154684-70154706 TCTCTTTGTTGAGGGATTGCTGG - Intergenic
1113233954 13:108248400-108248422 TTCCTCTGTGGAGGGAGGGAGGG + Intergenic
1114325347 14:21583295-21583317 TCCCAATGTGGAGGGATTACAGG + Intergenic
1114602049 14:23964833-23964855 TCCCGAAGTGCAGGGATTGCAGG + Intronic
1114606221 14:23999951-23999973 TCCCGAAGTGCAGGGATTGCAGG + Intronic
1114895921 14:26991305-26991327 TTCCTTTCTGGAAGGAGTGCAGG + Intergenic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116056204 14:39866647-39866669 TCCCTAGCAGGAGGGAGAGCAGG + Intergenic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1116907381 14:50417291-50417313 TCCCAAAGTGCTGGGAGTGCAGG - Intergenic
1117277816 14:54207287-54207309 TCCCAATGTGCTGGGATTGCAGG + Intergenic
1119054255 14:71402946-71402968 TCCAAATGTGGAGGGAGAGGGGG - Intronic
1119561982 14:75597826-75597848 TCCCAATGTGCTGGGATTGCAGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120340016 14:83207852-83207874 TCCCTAAGTGGTGGGATTACAGG - Intergenic
1120513233 14:85440460-85440482 TTCCAATGGGGAGGGAGGGCAGG + Intergenic
1120789301 14:88564059-88564081 TCCCTAGGTGCTGGGAGTGCGGG + Intronic
1122104806 14:99444598-99444620 TCCCAATGTGCAGGGATTACAGG - Intronic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1123449826 15:20352579-20352601 GCCCACTGTGGAGGGTGTGCAGG + Intergenic
1124546127 15:30628337-30628359 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1125736599 15:41931251-41931273 TCCCAAAGTGGTGGGATTGCAGG - Intronic
1125786820 15:42326014-42326036 TCCCAATGTGTTGGGATTGCAGG + Intronic
1125812515 15:42553563-42553585 TCCCTAAGTGCAGGGATTACAGG + Intronic
1125961129 15:43830786-43830808 TCCCAAAGTGCCGGGAGTGCAGG - Intronic
1126017356 15:44365266-44365288 TCCCAATGTGCTGGGACTGCAGG - Intronic
1126144877 15:45464942-45464964 TCCCAATGTGCTGGGATTGCAGG - Intergenic
1126459034 15:48895822-48895844 TCCCTAAGTGGTGGGATTACAGG - Intronic
1126880152 15:53085608-53085630 TCCCAATGTGCCGGGATTGCAGG + Intergenic
1127036596 15:54925092-54925114 TCCCAATGTGCTGGGATTGCAGG + Intergenic
1128596755 15:68959166-68959188 TCCCAAAGTGGTGGGATTGCAGG - Intronic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1128948789 15:71852619-71852641 TCCCAAAGTGGAGGGATTACAGG + Intronic
1129145281 15:73641488-73641510 TCCTTGTGTGGAGGGAGAACTGG - Intergenic
1129556211 15:76512548-76512570 TCCCATTGTGGAGGGTCTGCAGG - Intronic
1129596925 15:76972834-76972856 TGCCTATGAGGAGGGAGCGAGGG - Intergenic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1130550154 15:84885215-84885237 TCCCAAAGTGCTGGGAGTGCAGG + Intronic
1130923480 15:88368073-88368095 TCCCTAAGTGCTGGGATTGCAGG - Intergenic
1132102862 15:99038690-99038712 TCCCAATGAGGAGAAAGTGCTGG + Intergenic
1132668114 16:1091053-1091075 CCCCTGTGGGGAGGGAGTGGGGG + Intronic
1133634700 16:7653984-7654006 TGCCTCTGGGGAGGGAGGGCTGG - Intronic
1133803707 16:9106542-9106564 CCCCTAAGTGGTGGGATTGCAGG + Intronic
1134528787 16:14965773-14965795 TCCCAATGTGCTGGGAGTACAGG + Intergenic
1134908660 16:18004431-18004453 TCCCAAAGTGCTGGGAGTGCAGG + Intergenic
1135354595 16:21758580-21758602 TCCCTATGTGAAGGCAGGACAGG - Intronic
1135391101 16:22094030-22094052 TCCCAATGTGCTGGGATTGCAGG + Intronic
1135453085 16:22574720-22574742 TCCCTATGTGAAGGCAGGACAGG - Intergenic
1135589500 16:23695016-23695038 TACCTATGTGTAAAGAGTGCAGG + Exonic
1135677462 16:24429138-24429160 TCCCAATGTGCTGGGATTGCTGG - Intergenic
1135881379 16:26260954-26260976 TCCCAATGTGCAAGGATTGCAGG - Intergenic
1136536540 16:30902933-30902955 TCCCTAAGTGCTGGGATTGCAGG + Exonic
1137452334 16:48588551-48588573 TCCCAATGTGTTGGGATTGCAGG + Intronic
1137481234 16:48853363-48853385 TCCCTCTGTGTGGGGAGGGCCGG - Intergenic
1137635154 16:49979676-49979698 TCCCAAAGTGGTGGGATTGCAGG - Intergenic
1137675368 16:50301300-50301322 CCCCCATGTGGAGGGAGAGGTGG + Intronic
1138684723 16:58715083-58715105 TCCCTAAGTGCTGGGATTGCAGG - Intronic
1138974080 16:62182209-62182231 TCCCAAAGTGCAGGGATTGCAGG + Intergenic
1138983209 16:62295740-62295762 TCCCAATGTGTTGGGATTGCAGG - Intergenic
1139043460 16:63028980-63029002 TCCCTTAGTGGAAGGAATGCTGG - Intergenic
1139504402 16:67391878-67391900 GCCCTAGGCGCAGGGAGTGCTGG - Exonic
1139540779 16:67614436-67614458 TCCCTAGGTGCAGGGATTACAGG - Intronic
1139786323 16:69395478-69395500 TCCCAAAGTGGTGGGATTGCAGG - Intronic
1139867576 16:70075206-70075228 TCCCAATGTGCTGGGAGTACAGG - Intergenic
1140126717 16:72124267-72124289 TCCCAAAGTGTAGGGACTGCAGG + Intronic
1141507861 16:84491179-84491201 TCCCAAAGTGGAGGGATTACAGG - Intronic
1142419529 16:89961888-89961910 TCCCCCTGGGGAGGGAGAGCAGG + Intronic
1142653913 17:1377170-1377192 TCCCTAGGTGGTGGGATTACAGG + Intronic
1142779019 17:2165951-2165973 TCCCTAAGTGCTGGGATTGCAGG - Intronic
1143037111 17:4005611-4005633 TCCCTCTGTGCAGGGTCTGCAGG - Exonic
1143272046 17:5683073-5683095 TCTCTTTGTGGAAAGAGTGCTGG - Intergenic
1144597076 17:16579177-16579199 TCCCAAAGTGGAGGGATTACAGG + Intergenic
1144825676 17:18104466-18104488 GATCTATGTGGAGGGTGTGCTGG + Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1145882846 17:28364682-28364704 TCCCTGGGTGGAGGGGATGCTGG - Intronic
1146785840 17:35720678-35720700 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1147392108 17:40116194-40116216 TCCCTATTAGGAGGGACTACAGG + Intergenic
1147610909 17:41801369-41801391 TCCCGGTGTGCAGGGTGTGCAGG - Intergenic
1148184705 17:45633746-45633768 TCCCAAAGTGTAGGGAGTACAGG - Intergenic
1148344504 17:46894550-46894572 TCCCCATGGGGCGGAAGTGCCGG + Intergenic
1149319199 17:55467652-55467674 TCCCAAAGTGCAGGGATTGCAGG + Intergenic
1150097030 17:62385983-62386005 TCCCTAAGTGCAGGGATTACAGG + Intronic
1150271341 17:63867404-63867426 TCCCAATGTGCTGGGAGTACAGG + Intergenic
1150279567 17:63921312-63921334 TCCCTAAGTGGTGGGATTACAGG - Intergenic
1150421209 17:65037671-65037693 TCCCAATGTGTTGGGATTGCAGG - Intronic
1150849260 17:68688878-68688900 TCCATCTGTGGAGGGAGGGAAGG - Intergenic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1152928477 17:83098644-83098666 TCCTCATGTGGAGGGAGTCGAGG - Intergenic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1153130600 18:1851628-1851650 TCCCAAAGTGGTGGGATTGCAGG - Intergenic
1154965735 18:21354327-21354349 TCCCTAAGTGTTGGGACTGCAGG - Intronic
1155188061 18:23404727-23404749 TCCCAAAGTGCTGGGAGTGCTGG - Intronic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1156497610 18:37536419-37536441 TCCCTTTTAGGAGGGAGTGGGGG - Intronic
1156762450 18:40609648-40609670 TACATGTGTGGTGGGAGTGCTGG - Intergenic
1158372861 18:56829402-56829424 TCCACATGGGGAGGGGGTGCTGG - Intronic
1158414924 18:57241890-57241912 CTCCTATGAGGAGGGAGAGCAGG + Intergenic
1158455242 18:57600326-57600348 TCCCAAAGTGGAGGGATTACAGG + Intergenic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1159692765 18:71510553-71510575 TCCCAAAGTGCTGGGAGTGCTGG + Intergenic
1159899036 18:74025114-74025136 TCCCTGTGAGGAGGGAGGGGAGG - Intergenic
1160137263 18:76282977-76282999 TCCCTATGTGCTGGGATTACAGG + Intergenic
1160786263 19:901384-901406 TCCCCGTGTGGAGGGAGTGAGGG + Intronic
1161167016 19:2793431-2793453 TCCCAATGTGCAGGGATTACAGG - Intronic
1161197008 19:2992510-2992532 TCCCAAAGTGGTGGGATTGCAGG - Intronic
1161646842 19:5458256-5458278 TCCCGAAGTGCTGGGAGTGCAGG - Intergenic
1162150126 19:8639100-8639122 TCCCAAAGTGGTGGGATTGCAGG + Intergenic
1162369546 19:10270598-10270620 TCCCTCAGTGGAGGGAGCCCGGG + Intergenic
1162612237 19:11765785-11765807 TCCCAAAGTGGTGGGATTGCAGG + Intergenic
1163045635 19:14639672-14639694 TCCCAGTGTGCAGGGATTGCAGG + Intronic
1163344108 19:16729005-16729027 TCCCAATGTGCTGGGATTGCAGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163503910 19:17692824-17692846 GGCCTATGTGGAGGGAGGGAAGG + Intergenic
1163802618 19:19375992-19376014 TCCCAAAGTGGAGGGATTACAGG + Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164315268 19:24081862-24081884 TCCCAATGTGCAGGGATTACAGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164742301 19:30584835-30584857 TCCCAAAGTGCAGGGATTGCAGG - Intronic
1164949925 19:32328572-32328594 TCCCAATGTGCTGGGATTGCAGG - Intergenic
1165153579 19:33774526-33774548 TCCCCAGGTGGAGGAACTGCTGG + Intergenic
1165167502 19:33867079-33867101 TCCTGCTGTGGAGGGAGGGCAGG + Intergenic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1165705231 19:37971237-37971259 TCCCTAAGTGCTGGGAGTGCAGG + Intronic
1165803516 19:38566904-38566926 TCCCTAGGTGGATGGAGTGGAGG + Exonic
1165881206 19:39045308-39045330 TCCCAAAGTGCAGGGATTGCAGG - Intergenic
1166246812 19:41534199-41534221 TCCCTACATTGAAGGAGTGCTGG + Intergenic
1167002914 19:46756428-46756450 CCGCTATGTGGTGGGCGTGCTGG + Exonic
1167126753 19:47554833-47554855 TCCCAAAGTGGTGGGATTGCAGG - Intronic
1167341657 19:48920025-48920047 TCCCTAAGTGGTGGGATTACAGG + Intronic
1167479161 19:49718823-49718845 TCCCTAGGTGCAGGGATTACAGG - Intergenic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1167591861 19:50408639-50408661 TCCCAATGTGCTGGGATTGCAGG + Intronic
925353828 2:3223288-3223310 TGCATGTGTGGGGGGAGTGCAGG - Intronic
925400094 2:3566443-3566465 TCCCAAAGTGCTGGGAGTGCAGG + Intergenic
925751701 2:7095434-7095456 ACCCTGTGAGGAGGGAGGGCAGG + Intergenic
926174274 2:10575095-10575117 TCCCTCTGTGACAGGAGTGCTGG - Intronic
926733476 2:16055241-16055263 TCCCTATGTGTTGGGATTACAGG - Intergenic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
927496384 2:23554413-23554435 TCCCTATCTGGAGACAGCGCGGG + Intronic
927788526 2:25991426-25991448 TCCCTAAGTGGTGGGATTACAGG - Intergenic
927977198 2:27347873-27347895 TCCCTAAGTGCAGGGATTACAGG - Intronic
928157037 2:28886291-28886313 TCCCAATGTGCTGGGATTGCAGG - Intergenic
928520949 2:32088144-32088166 TCCCAAAGTGGTGGGAGTACAGG + Intronic
929073870 2:38061218-38061240 TCCCCATGTGAAGGAAATGCAGG + Intronic
929215530 2:39407832-39407854 TCCCAAAGTGCTGGGAGTGCAGG + Intronic
930053288 2:47233643-47233665 TCCCAATGTGCTGGGATTGCAGG + Intergenic
930055844 2:47251338-47251360 TCCCAAAGTGGTGGGAGTACAGG + Intergenic
930086500 2:47501348-47501370 TCCCAAAGTGCAGGGAGTACAGG + Intronic
931873050 2:66482116-66482138 TCCCAAAGTGGTGGGATTGCAGG + Intronic
932033936 2:68221071-68221093 TCCCAATGTGGTGGGATTACAGG - Intronic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933488832 2:82958798-82958820 TCCCTAAGTGTTGGGATTGCAGG - Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
935762484 2:106334238-106334260 TCCCTAAGTGCTGGGATTGCAGG + Intergenic
936446433 2:112599176-112599198 TCCCAATGTGCTGGGATTGCAGG + Intergenic
936519743 2:113204247-113204269 TCCCTAGATGGTGGGAGTCCTGG - Intronic
936544427 2:113378575-113378597 TCCCAATGTGCTGGGATTGCAGG + Intergenic
936615970 2:114048154-114048176 TCCCTATGTGCAGGGAGGAGGGG - Intergenic
937303055 2:120854989-120855011 GCTCTGTGTGGAGGGTGTGCAGG - Intronic
937771213 2:125722488-125722510 TCCTTATGGGGAAGAAGTGCAGG + Intergenic
937944152 2:127316112-127316134 TCCCAATGTCGTGGGATTGCAGG - Intronic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
938485860 2:131707310-131707332 TCCCTAAGTGGTGGGATTACAGG + Intergenic
939305464 2:140404428-140404450 TCCCAATGTGCTGGGATTGCAGG + Intronic
941622501 2:167793890-167793912 TCCCTATGCGGAGGGCATGAAGG - Intergenic
942387102 2:175454009-175454031 TCCCAAAGTGGTGGGATTGCTGG - Intergenic
942644281 2:178094268-178094290 TCCCTAAGTGCTGGGATTGCAGG - Intronic
943114662 2:183652488-183652510 TCTCTAAATGGTGGGAGTGCAGG + Intergenic
943855339 2:192783190-192783212 TCCCTAAGTGCTGGGATTGCAGG - Intergenic
943860656 2:192858094-192858116 TCCCAAAGTGCTGGGAGTGCTGG - Intergenic
944559679 2:200923506-200923528 TCCCAAAGTGAAGGGATTGCAGG + Intronic
946799200 2:223392170-223392192 TCCCAATGTGTTGGGATTGCGGG + Intergenic
947332076 2:229040158-229040180 TCCCAATGTGCTGGGATTGCTGG - Intronic
947363078 2:229365692-229365714 TCCCAATGTGCTGGGATTGCAGG + Intronic
947423118 2:229958525-229958547 TCCCTAAGTGGTGGGATTACAGG + Intronic
947894253 2:233654831-233654853 TCCCTAAGTGCAGGGATTACAGG - Intronic
947929129 2:233948772-233948794 TCCCAAAGTGCAGGGATTGCAGG - Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1169428372 20:5513548-5513570 TCCCTAAGTGGTGGGATTACAGG + Intergenic
1169925878 20:10783389-10783411 TCCCAAAGTGCTGGGAGTGCTGG + Intergenic
1170686040 20:18570417-18570439 TCCCAAAGTGCAGGGAGTACAGG - Intronic
1171286765 20:23946095-23946117 TCCCTATGTCCAGGGTGTCCAGG + Intergenic
1172099878 20:32478838-32478860 TCCCAAAGTGCTGGGAGTGCGGG + Intronic
1172260948 20:33564836-33564858 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1172538345 20:35691790-35691812 TCCCAAAGTGGAGGGATTACAGG - Intronic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1173943960 20:46935167-46935189 TTGCTATGTAGAGTGAGTGCAGG + Intronic
1173987655 20:47274971-47274993 TTCCTGTGTGAAGGGAGTGAGGG + Intronic
1174106617 20:48166734-48166756 TCCCTCTGTGGAGTGAGATCAGG + Intergenic
1174706158 20:52658240-52658262 TCCCAATGTGCTGGGATTGCAGG + Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1176922411 21:14704070-14704092 TCCCAATGTGCTGGGATTGCAGG + Intergenic
1177051625 21:16241974-16241996 TCCCTCTGTGGTGAGATTGCAGG + Intergenic
1177523204 21:22257550-22257572 TCCCAATGTGCTGGGATTGCAGG + Intergenic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1179776915 21:43670567-43670589 TGCCTCTGTAGAGGGAGAGCAGG + Intronic
1180660191 22:17460466-17460488 TCCCAAAGTGCAGGGATTGCAGG + Intronic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1181114015 22:20619952-20619974 TCCCAAGGTGCAGGGATTGCAGG - Intergenic
1181587234 22:23859745-23859767 TCCCAAAGTGCAGGGATTGCAGG + Intronic
1181907730 22:26212679-26212701 TCCCAATGTGGTGGGATTACAGG + Intronic
1182394929 22:30028386-30028408 TCTCTGTGTGGAGAGAGGGCGGG - Intronic
1183171001 22:36188197-36188219 GCCCAATGTGGAGGAAGAGCTGG + Intergenic
1183204101 22:36406614-36406636 TCCCTAAGTGCAGGGATTACAGG + Intergenic
1183229620 22:36573588-36573610 TCCCAAAGTGCCGGGAGTGCAGG + Intronic
1183293197 22:37015321-37015343 TCCCTTCTTGGAGGGAGTGAGGG - Intronic
1183868502 22:40723133-40723155 TCCCTAAGTGCAGGGATTACAGG - Intergenic
1184225417 22:43126886-43126908 TCCCTACTTGGAGGGGATGCGGG - Intronic
1184368340 22:44067098-44067120 TCCCAATGTGCTGGGAGTACAGG + Intronic
1184802812 22:46772884-46772906 TCCCAAAGTGCAGGGATTGCAGG + Intronic
950065691 3:10109760-10109782 TCCCAATGTGGTGGGATTACAGG + Intergenic
950145369 3:10646100-10646122 TGCCTATCTGGAGAGAGTTCTGG + Intronic
950492094 3:13312002-13312024 TCCCAAAGTGGTGGGATTGCAGG - Intergenic
950618786 3:14185090-14185112 TCCCAAAGTGGTGGGATTGCAGG - Intronic
951780683 3:26359984-26360006 TCCCTATTTGGTGGGACTACAGG + Intergenic
953618652 3:44513642-44513664 TACCTATGAGGAGGGGCTGCAGG - Intergenic
953971563 3:47352461-47352483 TCCCAAAGTGGAGGGATTACAGG - Intergenic
953980353 3:47410336-47410358 TCCCTATGTGGGGGTAGGGCCGG + Exonic
954095141 3:48320289-48320311 TCCCAAAGTGCTGGGAGTGCAGG - Intronic
954794463 3:53154521-53154543 TACCTCTCTGGAGGGAGAGCTGG - Intergenic
955133824 3:56196277-56196299 TCTCTGTGAGGAGGGAGTGTGGG - Intronic
956503512 3:69912262-69912284 TGCCTCTGGGGAGGGAGAGCAGG + Intronic
956518829 3:70081369-70081391 TCCCAAAGTGGAGGGATTACAGG + Intergenic
957826119 3:85446858-85446880 TCCCTATGTGCTGGGATTACAGG + Intronic
959708368 3:109359939-109359961 TCCCAATGTGCTGGGATTGCAGG + Intergenic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
961317765 3:126052264-126052286 ACCCTATGTGGAGGGTGTGCAGG - Intronic
964691648 3:159456301-159456323 TCTCTATGTTGAGGGAATGATGG + Intronic
964738320 3:159939553-159939575 TCCCAAAGTGGAGGGATTACTGG + Intergenic
964752274 3:160063606-160063628 TCCCAAAGTGGTGGGAGTTCAGG + Intergenic
964753560 3:160074620-160074642 TCCCTGTGTGGAAGGAATGTGGG - Intergenic
964917910 3:161858166-161858188 TCCCAAAGTGCAGGGATTGCAGG + Intergenic
964945238 3:162214627-162214649 TCCACATGTGGAGTGAGTGGAGG - Intergenic
965008733 3:163058320-163058342 TCCCTATGAGGCTGGAGTCCAGG + Intergenic
965390362 3:168096000-168096022 TCCCTTCGGGGAGGCAGTGCCGG + Intergenic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966237059 3:177713481-177713503 TCCCTATGTGCTGGGATTACAGG + Intergenic
966559002 3:181297858-181297880 TGCCTGTGTGGAGGGAGGGCAGG - Intergenic
967305393 3:188054008-188054030 TCCCTATGTGGACGGAGAACAGG - Intergenic
967955333 3:194873435-194873457 TCCCGATGTGTAGGGATTTCAGG - Intergenic
968200832 3:196753450-196753472 TCCCTAAGTGCTGGGATTGCAGG + Intronic
968842018 4:3014533-3014555 TCCCTAAGTGGTGGGATTACAGG - Intronic
969723973 4:8908331-8908353 TCCCTGGGTGGAGGGACTGGCGG - Intergenic
970521045 4:16884064-16884086 TCCCTTTGTGGAGGGTGGACTGG - Intronic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
971714863 4:30162980-30163002 TCCCAATGTGTTGGGATTGCAGG - Intergenic
972455062 4:39246245-39246267 TCCCAAAGTGCAGGGATTGCAGG - Intronic
972465445 4:39351701-39351723 TCCCAAAGTGGAGGGATTACAGG - Intronic
972570949 4:40310025-40310047 TCCCAATGTGCTGGGATTGCAGG - Intergenic
972585316 4:40432110-40432132 TCCCTATGTGCTGGGATTACAGG + Intronic
972597497 4:40542793-40542815 TCCCTATGTGCTGGGATTGCAGG + Intronic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
972942876 4:44218390-44218412 TCCCAAAGTGGTGGGAGTACAGG + Intronic
974081859 4:57222078-57222100 TCCCAATGTGCTGGGATTGCAGG + Intergenic
974973615 4:68862179-68862201 TCCCAAAGTGCAGGGACTGCAGG + Intergenic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
975452946 4:74551336-74551358 TCCCAAAGTGGAGGGATTACAGG - Intergenic
975830875 4:78367144-78367166 TCCCTAAGTGGTGGGATTACAGG - Intronic
976226881 4:82801082-82801104 TCCCAAAGTGGTGGGATTGCAGG + Intergenic
976997798 4:91457406-91457428 TCCCAAAGTGTAGGGAGTACAGG - Intronic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
979566090 4:122155580-122155602 TCCCTAAGTGGTGGGATTACAGG + Intronic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
980383203 4:132054281-132054303 TCACTAAGTGGATTGAGTGCTGG + Intergenic
980484462 4:133437814-133437836 TGCCTTTGTGGAGGGTCTGCTGG - Intergenic
981181801 4:141754962-141754984 TCCCTTTCTGAAGGGAGTTCTGG + Intergenic
982226738 4:153173707-153173729 TCCCAAAGTGCAGGGATTGCAGG - Intronic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
983021841 4:162686170-162686192 TCCCAAAGTGCTGGGAGTGCTGG + Intergenic
983081235 4:163387597-163387619 ACCCTATGTGGAGGGTGTCAGGG + Intergenic
983590570 4:169406180-169406202 TCCCAATGTGGTGGGATTGTAGG + Intronic
984475532 4:180229959-180229981 TCCCAATGTGCTGGGATTGCAGG + Intergenic
984821355 4:183885516-183885538 TCCATCTGTGGAGGCTGTGCAGG + Intronic
985475049 5:74144-74166 TCCGTGTGTGGAGGGAGCCCCGG - Intergenic
986225500 5:5807981-5808003 TCACCATGTGTAGGGATTGCAGG - Intergenic
987015148 5:13810480-13810502 TCCCAAAGTGGTGGGAGTACAGG - Intronic
987365911 5:17148449-17148471 TCCCAAAGTGGTGGGAGTACAGG + Intronic
987714867 5:21554904-21554926 TCCATGTGTTGAAGGAGTGCTGG + Intergenic
988916396 5:35898109-35898131 TCCCAAAGTGGTGGGATTGCAGG + Intergenic
989331260 5:40261689-40261711 TCCCAATGTGGTGGGATTACAGG - Intergenic
989397886 5:40977873-40977895 TCCCAAAGTGCTGGGAGTGCAGG - Intronic
989758360 5:44983678-44983700 TTCTTATGTTCAGGGAGTGCTGG + Intergenic
990308185 5:54513345-54513367 TCCCAAAGTGCTGGGAGTGCAGG + Intergenic
991475787 5:67017853-67017875 TCCCAAAGTGCAGGGATTGCAGG + Intronic
991577018 5:68115224-68115246 TCCCTAAGTGGTGGGATTACAGG + Intergenic
991583233 5:68178024-68178046 TCCCAAAGTGGAGGGATTACAGG - Intergenic
991707911 5:69377010-69377032 TCCCTAAGTGCTGGGATTGCAGG + Intronic
992759559 5:79939455-79939477 TCCATATCTTGAGGGATTGCAGG - Intergenic
992793468 5:80234513-80234535 GCCCTTTGTGGTGGGAGTGGTGG - Intronic
993516411 5:88841249-88841271 TCCCAAAGTTCAGGGAGTGCAGG - Intronic
994188319 5:96839670-96839692 TCCCTCTGAGCAGGGAGTGAAGG - Intronic
994748761 5:103711958-103711980 TCCCAAAGTGAAGGGAGTACAGG + Intergenic
995167275 5:109058996-109059018 TCCCTAAGTGGTGGGATTACAGG + Intronic
996006949 5:118432837-118432859 TCCCAAAGTGGTGGGATTGCAGG - Intergenic
997291959 5:132743313-132743335 TCCCAAAGTGGTGGGATTGCAGG + Intergenic
997342349 5:133154499-133154521 TCCCAATGTGCAGGGATTACAGG - Intergenic
997364704 5:133318549-133318571 TGCCTGTGTGGAGGGTCTGCAGG + Intronic
997565061 5:134880699-134880721 TCCCTAAGTGCTGGGAGTACAGG + Intronic
997640349 5:135444918-135444940 TTCCTGTGTGGATGGAGTGTTGG + Exonic
997800962 5:136861635-136861657 TCCCTGGGTGGTGGGAGTGAGGG + Intergenic
998098702 5:139413853-139413875 TGCCTATGTGAATGGAGTTCAGG - Exonic
998263494 5:140649093-140649115 TCCCAAAGTGGTGGGAGTACAGG + Intronic
998770319 5:145536551-145536573 TTCCTATGTGGAGGGAAAGCTGG + Intronic
1000645336 5:163754637-163754659 TCAGTTTGTGGAGGGAGTGTAGG - Intergenic
1000914654 5:167066053-167066075 TCCCTGGGTGGTGTGAGTGCTGG + Intergenic
1001503325 5:172255828-172255850 TCCCAAAGTGGTGGGATTGCAGG - Intronic
1001505788 5:172279034-172279056 TCCCAATGTGGTGCGAATGCAGG + Intronic
1001811278 5:174630129-174630151 TCCCTAAGTGCTGGGATTGCGGG - Intergenic
1002119784 5:176993747-176993769 TCCCAATGTGGTGGGATTACAGG - Intronic
1002185713 5:177454013-177454035 TGCCCATCTGGAGTGAGTGCAGG + Exonic
1003133950 6:3418634-3418656 TCCCCCTGGGGAGGGGGTGCAGG + Intronic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003634217 6:7817285-7817307 TGCTTATGTGGAGGTGGTGCAGG + Intronic
1003838718 6:10098459-10098481 TCCCAATGTGCTGGGATTGCAGG - Intronic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1004723000 6:18284775-18284797 TCCCTAAGTGGCGGGATTACAGG - Intergenic
1005258781 6:24034190-24034212 TCCCAAAGTGCAGGGAGTACAGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1005479435 6:26241354-26241376 TCCCAAAGTGCAGGGATTGCAGG + Intergenic
1005487791 6:26317622-26317644 TCCCAAAGTGCAGGGATTGCAGG + Intergenic
1005922515 6:30415111-30415133 TCCCTGTGTGGGCTGAGTGCCGG - Intergenic
1006059681 6:31410944-31410966 TCCCTGTGTGGGCTGAGTGCCGG - Intronic
1006148666 6:31974457-31974479 TCCCAAAGTGGTGGGAGTACAGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1006964255 6:37966019-37966041 TCCCTAAGTGCTGGGATTGCAGG + Intronic
1007004484 6:38347736-38347758 TCCCAATGTGGTGGGATTACAGG - Intronic
1007162168 6:39800588-39800610 TCCCCAGCTGCAGGGAGTGCTGG + Intronic
1007257972 6:40541822-40541844 TGTCTATGGGGAGGGGGTGCTGG - Intronic
1009947990 6:70362423-70362445 TCCCAATGTGCTGGGATTGCAGG - Intergenic
1011504960 6:88031282-88031304 TCCTTATTTTGAGAGAGTGCTGG - Intergenic
1011609615 6:89138181-89138203 TCCCTAAGTGTTGGGAGTACAGG + Intergenic
1012298631 6:97556156-97556178 TCCCCAAGTGAAGGGAGTTCAGG + Intergenic
1012820296 6:104078416-104078438 TCCCTATGTGCTGGGAGTACAGG + Intergenic
1013101335 6:106989498-106989520 TCCCAATGTGGTGGGATTACAGG - Intergenic
1013181105 6:107717804-107717826 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1013212923 6:108002808-108002830 TCCCTATGGGGAAGGAGGGAGGG - Intergenic
1013801914 6:113955767-113955789 TCCCAAAGTGGAGGGATTACAGG + Intronic
1014273865 6:119365104-119365126 TAACTATGTGGAGGGAGTAGGGG - Intergenic
1014434615 6:121407872-121407894 TCCCAATGTGCTGGGATTGCAGG + Intergenic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1015921033 6:138266589-138266611 TCCCAAAGTGGTGGGATTGCAGG - Intronic
1017079636 6:150655448-150655470 TCCCTAAGTGCTGGGATTGCAGG - Intronic
1017835029 6:158168837-158168859 TCCCAATGTGCTGGGATTGCAGG - Intronic
1018123825 6:160662645-160662667 TCTGTGTGTGTAGGGAGTGCAGG - Intronic
1018498855 6:164380647-164380669 TCCCAAAGTGCAGGGATTGCAGG + Intergenic
1018550290 6:164989872-164989894 TCCCTATGTGCTGGGATTACAGG + Intergenic
1018838355 6:167501649-167501671 TCACTATGTTGAGGGAGAGAAGG + Intergenic
1019398721 7:838174-838196 TCCCTAAGTGCTGGGATTGCAGG + Intronic
1019683010 7:2363192-2363214 TCCCTAAGTGCTGGGATTGCAGG - Intronic
1019699363 7:2466539-2466561 TCCCTAAGTGCTGGGAGTTCAGG + Intergenic
1019938143 7:4269663-4269685 TCCCTAAGTGCTGGGACTGCAGG + Intergenic
1021542907 7:21780284-21780306 TCCCTAAGTGCAGGGATTACAGG - Intronic
1022104200 7:27186527-27186549 TCCCCAGGTGCAGGGAGTTCGGG - Intergenic
1022136903 7:27457543-27457565 TTCCTATTTAGAGGGAGTCCTGG - Intergenic
1022390330 7:29938288-29938310 TCCCAAAGTGCTGGGAGTGCGGG + Intronic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1022715964 7:32898797-32898819 TCCCTATGTGCTGGGATTACAGG + Intergenic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1025152438 7:56569197-56569219 TCCCAAAGTGGTGGGATTGCAGG + Intergenic
1025220447 7:57103269-57103291 TCCCTCTGTGGTGGGAGAACTGG + Intergenic
1025275329 7:57577900-57577922 TCCCAAAGTGCTGGGAGTGCAGG - Intergenic
1025631264 7:63275090-63275112 TCCCTCTGTGGTGGGAGAACTGG + Intergenic
1026096732 7:67352354-67352376 TCCCAATGTGCTGGGATTGCAGG - Intergenic
1026235180 7:68520964-68520986 TCCCAATGTGCTGGGATTGCAGG + Intergenic
1026388860 7:69879406-69879428 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1026572631 7:71544889-71544911 TCCCGATGTGATGGGGGTGCAGG - Intronic
1026926238 7:74195906-74195928 TTCCTATTTAGAGGGAGTCCTGG + Exonic
1027001981 7:74659799-74659821 TCCCAAAGTGGTGGGAGTACAGG + Intronic
1027206420 7:76103513-76103535 TCCCAAAGTGGTGGGACTGCAGG - Intergenic
1027884648 7:83889407-83889429 TCCCAATGTGGTGGGATTACAGG - Intergenic
1028560952 7:92175387-92175409 TCCCTAAGTGCTGGGATTGCAGG - Intronic
1029281038 7:99435695-99435717 TCCCAAAGTGCTGGGAGTGCAGG - Intronic
1029556092 7:101270325-101270347 TCCCAAAGTGCAGGGATTGCAGG - Intergenic
1031494131 7:122425327-122425349 TCCCAATGTGCAGGGATTACAGG - Intronic
1031889194 7:127274484-127274506 TCCCAAAGTGCTGGGAGTGCAGG + Intergenic
1032070534 7:128803390-128803412 TCCCAAAGTGGTGGGAGTACAGG - Intronic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1032863403 7:135903014-135903036 TCCCAAAGTGCAGGGATTGCAGG - Intergenic
1032929485 7:136649768-136649790 TCTCTATGTGGATGGAATCCTGG - Intergenic
1032960293 7:137025888-137025910 TCCCTAAGTGGTGGGATTACAGG - Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034433349 7:151051661-151051683 TCCCAAAGTGCAGGGAGTACAGG + Intronic
1035695702 8:1593971-1593993 CCCCTATGTGGCTGGACTGCTGG - Intronic
1037436706 8:18870839-18870861 TCCCTAAGTGGTGGGATTACAGG - Intronic
1038614473 8:29080081-29080103 TCCCAAAGTGGTGGGATTGCAGG - Intronic
1038807590 8:30809680-30809702 TCCCAAAGTGCAGGGATTGCGGG - Intronic
1039169134 8:34721864-34721886 TCCCTAAGTGCTGGGATTGCAGG + Intergenic
1039288589 8:36069383-36069405 TCCCTAAGTGTTGGGATTGCAGG - Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1039606857 8:38888010-38888032 TCCCAAAGTGTTGGGAGTGCAGG + Intergenic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1041400856 8:57443210-57443232 TCCCTATGTTGCCAGAGTGCTGG + Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1042289970 8:67160138-67160160 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1044664060 8:94618276-94618298 TCCCAAAGTGTAGGGATTGCAGG - Intergenic
1045123972 8:99069172-99069194 TCCCAATGTGCAGGGATTACAGG - Intronic
1045370182 8:101515076-101515098 TCCCTATAAGGAGGGAGGGAGGG - Intronic
1045465231 8:102463470-102463492 TCCCCAAGTGGAGTGATTGCGGG - Intergenic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047004409 8:120604707-120604729 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1048974164 8:139661916-139661938 TTCCTGTGGGGAGGGACTGCTGG + Intronic
1049439703 8:142603705-142603727 TCCCTAAGTGCTGGGATTGCAGG + Intergenic
1049524110 8:143112258-143112280 TCCATTTGTGGAGGGAACGCAGG + Intergenic
1049544608 8:143224192-143224214 TCCATTTGTGGAGGGAACGCAGG - Intergenic
1050087898 9:1985658-1985680 TCCCAAAGTGCTGGGAGTGCAGG + Intergenic
1053186349 9:36019858-36019880 TCAATTTGTGGAGGGAATGCAGG + Intergenic
1053290983 9:36879547-36879569 TCCCTGGGTGTGGGGAGTGCTGG + Intronic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1055018902 9:71648071-71648093 TCCCAAAGTGCTGGGAGTGCAGG + Intergenic
1055954359 9:81760568-81760590 TCCCAAAGTGCTGGGAGTGCAGG + Intergenic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1057334606 9:94146133-94146155 TCCCAAAGTGCTGGGAGTGCAGG + Intergenic
1057339580 9:94187969-94187991 TCCCAATGTGCTGGGATTGCAGG - Intergenic
1058010513 9:99971760-99971782 TCCCTAAGTGCTGGGATTGCAGG - Intergenic
1059737152 9:117113395-117113417 TCCCAATGTGCTGGGATTGCAGG - Intronic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1060500327 9:124148710-124148732 TCCCTATGTGCTGGGATTACAGG + Intergenic
1060633097 9:125177436-125177458 TCCCTAAGTGGTGGGATTACAGG - Intronic
1061771403 9:132926202-132926224 TCCCAAAGTGCAGGGATTGCCGG - Intronic
1062277293 9:135736975-135736997 CCCCTACGTGGGGGGAGTGGGGG - Intronic
1062467699 9:136688265-136688287 TCCCTATGAGGAGGGACCCCAGG - Intergenic
1062570342 9:137182090-137182112 TCCCTATGTGCTGGGATTGCAGG - Intronic
1185599192 X:1327389-1327411 TCCCTAAGTGGTGGGATTACAGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186484634 X:9924612-9924634 TCCCTAAGTGTTGGGATTGCAGG + Intronic
1186853601 X:13604381-13604403 TCCCTCTGGGGCAGGAGTGCTGG + Intronic
1186890329 X:13953505-13953527 TCCCAAAGTGCTGGGAGTGCAGG - Intergenic
1187333033 X:18357999-18358021 TCCCAAAGTGGAGGGATTACAGG - Intergenic
1187754682 X:22509571-22509593 TCCCAAAGTGGTGGGATTGCAGG + Intergenic
1188590266 X:31824507-31824529 TCCCAATGTGCTGGGATTGCAGG + Intronic
1189113912 X:38324356-38324378 TCCCTAAGTGCTGGGATTGCAGG + Intronic
1189226348 X:39416480-39416502 TGCCTGTGTGGAGGGATTTCAGG - Intergenic
1189392382 X:40587009-40587031 TCCCTATGTGCTGGGATTACAGG - Intronic
1190120438 X:47655020-47655042 TCCCTAAGTGCTGGGATTGCAGG - Intronic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1190558802 X:51667024-51667046 TCCCAAAGTGGTGGGAGTACAGG - Intergenic
1190761962 X:53444389-53444411 TCCCTAAGTGTTGGGATTGCAGG - Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1191782618 X:64885162-64885184 TCCCTAGGTGCTGGGATTGCAGG + Intergenic
1192022200 X:67405418-67405440 TCCCTATGTGCTGGGATTACAGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193472016 X:81917850-81917872 TCCCAATGTGTTGGGACTGCAGG - Intergenic
1193809109 X:86030676-86030698 TCCCTCTGTAGAGGGAGTCATGG + Intronic
1194740448 X:97566590-97566612 TCCCTATGTGAAACGTGTGCAGG - Intronic
1195302613 X:103545692-103545714 TCCCTATGTGCTGGGATTACAGG - Intergenic
1195371598 X:104180237-104180259 TCCCAATGTGGTGGGAATACAGG + Intronic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1199440077 X:147857822-147857844 TCCCAATGTTGAGGGAGACCCGG - Intergenic
1199745642 X:150770617-150770639 GCCCTATGAGGATGGAGTGCCGG - Intronic
1200082762 X:153587172-153587194 TGCTTATGTGGAGGGAGAGATGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1200548593 Y:4550271-4550293 TCCCTAAGTGGTGGGATTACAGG + Intergenic
1201264905 Y:12196680-12196702 TCTGTATGCTGAGGGAGTGCTGG - Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1201988842 Y:20002141-20002163 TCCCAAAGTGCAGGGACTGCAGG + Intergenic
1202237472 Y:22728550-22728572 TCCCTGCGTTGAGGGTGTGCTGG - Intergenic