ID: 916530643

View in Genome Browser
Species Human (GRCh38)
Location 1:165653260-165653282
Sequence ATGTGTGATAGGAATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 363}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916530643_916530651 0 Left 916530643 1:165653260-165653282 CCATCCCCATTCCTATCACACAT 0: 1
1: 0
2: 2
3: 35
4: 363
Right 916530651 1:165653283-165653305 CCCTGGATCCCATTCCTTATGGG 0: 1
1: 0
2: 0
3: 7
4: 142
916530643_916530656 28 Left 916530643 1:165653260-165653282 CCATCCCCATTCCTATCACACAT 0: 1
1: 0
2: 2
3: 35
4: 363
Right 916530656 1:165653311-165653333 CTGAAAAATAAGAGCTAGTTTGG 0: 1
1: 0
2: 1
3: 20
4: 325
916530643_916530658 30 Left 916530643 1:165653260-165653282 CCATCCCCATTCCTATCACACAT 0: 1
1: 0
2: 2
3: 35
4: 363
Right 916530658 1:165653313-165653335 GAAAAATAAGAGCTAGTTTGGGG 0: 1
1: 0
2: 0
3: 36
4: 380
916530643_916530649 -1 Left 916530643 1:165653260-165653282 CCATCCCCATTCCTATCACACAT 0: 1
1: 0
2: 2
3: 35
4: 363
Right 916530649 1:165653282-165653304 TCCCTGGATCCCATTCCTTATGG 0: 1
1: 0
2: 3
3: 16
4: 178
916530643_916530657 29 Left 916530643 1:165653260-165653282 CCATCCCCATTCCTATCACACAT 0: 1
1: 0
2: 2
3: 35
4: 363
Right 916530657 1:165653312-165653334 TGAAAAATAAGAGCTAGTTTGGG 0: 1
1: 2
2: 2
3: 35
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916530643 Original CRISPR ATGTGTGATAGGAATGGGGA TGG (reversed) Intronic
900736705 1:4303705-4303727 GTGTGTGAAAGGGAAGGGGAAGG - Intergenic
902550526 1:17216506-17216528 AGGTTTGAAAGGAGTGGGGAAGG + Intronic
903320038 1:22537585-22537607 GTGTGTGATGGGAAGTGGGAGGG - Intergenic
903369982 1:22829282-22829304 GTGTGTGCTAGGGGTGGGGAGGG - Intronic
903626118 1:24731303-24731325 ATGGGTGATAGGAGTGGGGCAGG + Intergenic
903937947 1:26909746-26909768 ATGTGCCAGAGGGATGGGGAGGG + Intronic
904086973 1:27916196-27916218 ATGGGTGGGAGGAAAGGGGAGGG - Intergenic
904464962 1:30702159-30702181 ATGAGTGATGGGAAAGTGGAGGG - Intergenic
904574731 1:31497863-31497885 AGGGGAGAGAGGAATGGGGAGGG - Intergenic
905218367 1:36426475-36426497 ATGTGTGACAGGCAATGGGATGG - Intronic
905755465 1:40505621-40505643 ATGTGTGAAGGGGTTGGGGAGGG + Intergenic
905812636 1:40923717-40923739 TTGTGGGATGGGAATGGGGGCGG + Intergenic
906074685 1:43043261-43043283 ATGTTTGAAAAGAACGGGGATGG + Intergenic
906151511 1:43590546-43590568 ATGTGTAATAGGCAGGGGAAGGG - Intronic
906173006 1:43743848-43743870 ATGTAATATAGGAATGGGGGGGG - Intronic
906616853 1:47239319-47239341 ATCTGTAATAGGAATGGGGTGGG + Intergenic
907457284 1:54583823-54583845 ATGTGTGAGAAAAATGAGGAGGG - Intronic
907748903 1:57243495-57243517 GTGTGTGCTAGGAATGAGGAGGG + Intronic
908775025 1:67631594-67631616 ATGAGAGATAGGAAAGGAGAGGG + Intergenic
909879151 1:80850596-80850618 ATGTGTGAAAGGAAATAGGAAGG + Intergenic
910995835 1:93103751-93103773 ATCAGTGATAGTAATGGGGTGGG + Intronic
911757360 1:101574517-101574539 AAGTGAAATTGGAATGGGGAAGG - Intergenic
912067937 1:105768959-105768981 ATATGTGAGTGGAATGGGGGTGG + Intergenic
912750203 1:112281148-112281170 AAGTCTGAGAGGTATGGGGATGG - Intergenic
912969197 1:114264603-114264625 ATCAGTGATTGGAATGGGAAAGG + Intergenic
913310338 1:117483933-117483955 ATGTGTTTCAGGTATGGGGAGGG + Intronic
913557247 1:119980265-119980287 ATGTCTGCTGGGAATGGGAAAGG - Intronic
915265759 1:154716301-154716323 ATGGCTGACAGAAATGGGGATGG - Intronic
915356012 1:155255469-155255491 AAGGGGGATGGGAATGGGGATGG + Intronic
915838349 1:159196145-159196167 TTGTGTGATAGGATTCTGGAAGG - Intronic
916530643 1:165653260-165653282 ATGTGTGATAGGAATGGGGATGG - Intronic
917598511 1:176553100-176553122 ATGTGTGATGGAATTGAGGAGGG + Intronic
917791876 1:178504270-178504292 CTCAGTGATAGGAATGGGAATGG - Intergenic
918585868 1:186187788-186187810 ATGTGTGACTAGAATGTGGAGGG - Intronic
918617028 1:186556613-186556635 ATGTGAGATGTGGATGGGGAAGG + Intergenic
919796860 1:201326075-201326097 ATGTGTGAGAGGCCTGGGGTGGG + Intronic
919897115 1:202015857-202015879 CTGTGGGAGAGGAGTGGGGAGGG - Exonic
921007990 1:211112838-211112860 GTGCGTGCTAGGAATGGGGAAGG - Intronic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
922146803 1:222954685-222954707 AAGTGTCATAGGAGAGGGGAGGG + Intronic
923028551 1:230226729-230226751 ATGGGTGAGTGAAATGGGGAGGG - Intronic
1063473492 10:6307958-6307980 GTGAGAGAAAGGAATGGGGAAGG - Intergenic
1063921558 10:10938723-10938745 ATGTGAGACAGGAATGGGGGAGG + Intergenic
1063981668 10:11457554-11457576 ATGTGGGGTAGGCATGGGGGTGG - Intronic
1064624476 10:17248327-17248349 ATATTGGATAGGAGTGGGGATGG - Intergenic
1064802859 10:19095616-19095638 ATGATTGATAGGTATGGGGAGGG + Intronic
1064934236 10:20662335-20662357 ATGTGTGTGTGGCATGGGGAAGG - Intergenic
1069820228 10:71222961-71222983 AGGTGGGATAGGGATGGGGGAGG - Intronic
1070011302 10:72477202-72477224 ATGTTTGATTTGAATGGAGATGG - Exonic
1070566981 10:77611142-77611164 AGGTCTGCAAGGAATGGGGAAGG - Intronic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1071491102 10:86137017-86137039 GGGTGTGATGGGAATGGGGAAGG - Intronic
1071589805 10:86862197-86862219 AGGAGTGCTAGGCATGGGGATGG + Intronic
1072445494 10:95495394-95495416 ATGTTTGGTAGGAATGAGGGTGG - Intronic
1075455241 10:122580744-122580766 CTGTGTGATAGGAACTAGGATGG + Intronic
1075457364 10:122593447-122593469 CTGTGTGATAGGAACTAGGATGG + Intronic
1075458437 10:122599943-122599965 CTGTGTGATAGGAACTAGGATGG + Intronic
1075458942 10:122602978-122603000 CTGTGTGATAGGAACTAGGATGG + Intronic
1075459574 10:122607037-122607059 CTGTGTGATAGGAACTAGGATGG + Intronic
1075460206 10:122611096-122611118 CTGTGTGATAGGAACTAGGATGG + Intronic
1075460838 10:122615155-122615177 CTGTGTGATAGGAACTAGGATGG + Intronic
1075700965 10:124469181-124469203 AAGTGTGATTGGAGTGGGGTGGG + Intronic
1076212950 10:128664949-128664971 CTGGGGGATGGGAATGGGGAAGG + Intergenic
1077130250 11:968452-968474 TTGTGGGACAGGGATGGGGACGG - Intronic
1077388413 11:2286927-2286949 AAGTGTTAAAGGAAAGGGGAAGG - Intergenic
1077696073 11:4393697-4393719 AAGTCTGAGAGGAAAGGGGAGGG + Intergenic
1077777799 11:5290984-5291006 ATGAGAGAGAGAAATGGGGAGGG + Intronic
1079452140 11:20606446-20606468 GTGTGTGATGGGGATGGAGATGG + Intronic
1080042354 11:27772150-27772172 TTGTGTGTTAGGATAGGGGATGG + Intergenic
1080886425 11:36372275-36372297 ATGAGTAATGGGAATGGGGTGGG + Intronic
1081425664 11:42923912-42923934 ATGTTGAATAGGAATGGTGATGG + Intergenic
1083287202 11:61667743-61667765 CTGGGTGAGAGGGATGGGGAGGG + Intergenic
1084149112 11:67279915-67279937 GTGTGGGAGAGGAAGGGGGAGGG + Intronic
1085143314 11:74170174-74170196 AGGTGTGATAGGATTGGAGTGGG - Intronic
1085858285 11:80201154-80201176 ATGTGTGTGAGGATGGGGGAGGG - Intergenic
1087418529 11:97889482-97889504 AAGTGAGATAGGAATGTGGCAGG - Intergenic
1087786712 11:102363288-102363310 ATTTGTGATGGGATTGGAGAAGG + Intronic
1089344718 11:117783830-117783852 ATGTGTGTTTGGAATGCGGTTGG - Intronic
1089930468 11:122305374-122305396 AGGTGTGAAATGAAGGGGGAAGG - Intergenic
1091770855 12:3150351-3150373 ATGGGGGGCAGGAATGGGGAGGG + Intronic
1092487604 12:8915404-8915426 ATGGGACATAGGAAGGGGGACGG - Intronic
1096028844 12:48393365-48393387 ATGTTTAATAGGAATGGTGAGGG + Intergenic
1097062960 12:56299873-56299895 ATGTCTGAAATGAAAGGGGAAGG - Intronic
1098187250 12:67910618-67910640 ATGTGTGTTAGTAAAAGGGATGG - Intergenic
1098859036 12:75687012-75687034 AAGTGTGATAGGAAGGGTAACGG - Intergenic
1099282339 12:80666862-80666884 ATGGGTGATATCAATGGAGATGG - Intronic
1099385212 12:82005819-82005841 CTCTGTGACAGAAATGGGGAGGG - Intergenic
1099494354 12:83327938-83327960 ATGAGCGAGAGGAGTGGGGAAGG + Intergenic
1099558124 12:84137047-84137069 GTGTCTGCTAGGAAAGGGGAAGG - Intergenic
1099629954 12:85129997-85130019 ATGAGAGATAGGAATCAGGAAGG + Intronic
1101469608 12:104984252-104984274 ATGGGGAATAGGAAAGGGGATGG + Intergenic
1101858310 12:108462719-108462741 AAGTGGGAGGGGAATGGGGAGGG - Intergenic
1102417799 12:112779681-112779703 AGGTGTGATGGGTATGGAGATGG - Intronic
1102425492 12:112840936-112840958 GTGTGTGATGTGAATGGGAATGG - Intronic
1103121798 12:118386565-118386587 TTTTGTGCTAGGATTGGGGAGGG + Intronic
1103542119 12:121673277-121673299 AGGTGTGAGTGGAAAGGGGAGGG - Intergenic
1103804680 12:123563177-123563199 GTGTGTGGTGGGTATGGGGAGGG + Intergenic
1104818052 12:131659945-131659967 TTGGGGGATGGGAATGGGGAGGG + Intergenic
1106364679 13:29067045-29067067 ATGTTTTATAGGATTGGGGGTGG + Intronic
1106911598 13:34468906-34468928 ATGTGTGATAGTAATGCCAAAGG - Intergenic
1106955451 13:34933324-34933346 ATTTGGGATTAGAATGGGGATGG + Intergenic
1107428785 13:40319862-40319884 ACGCGTGCTGGGAATGGGGAGGG + Intergenic
1107897872 13:44984059-44984081 GTATGTGAAAGGTATGGGGAAGG - Intronic
1108002339 13:45915789-45915811 CGGTGTGGTAGGAATGGGGTGGG + Intergenic
1109620134 13:64893085-64893107 ATGTGTGTTAGGCAAGGGGATGG - Intergenic
1109723081 13:66301851-66301873 AAATGTGGTAGGAATGGGAAAGG + Intergenic
1112910449 13:104476463-104476485 GTGAGTGATGGCAATGGGGAAGG + Intergenic
1113082064 13:106530664-106530686 ATGCGTCATAGGAATGGGAGTGG - Intronic
1113296459 13:108964232-108964254 TTGAGTGATAGGTTTGGGGAAGG - Intronic
1113514113 13:110878467-110878489 ATCTGTGGAAGGAATGGGAAGGG - Intergenic
1114889665 14:26902364-26902386 ATGTGTGATAAAAATGAAGAAGG - Intergenic
1118102756 14:62624936-62624958 GTGTGTGAAAGGAAAGAGGAGGG - Intergenic
1119416904 14:74477025-74477047 GTGTGTGTTGGGAATGGGGCTGG - Intronic
1119416916 14:74477104-74477126 GTGTGTGTTGGGAATGGGGCTGG - Intronic
1120174255 14:81276785-81276807 CTGTGTGATGGGAGTGGTGATGG - Intronic
1120948964 14:90023340-90023362 CTGTGTGCTTGGAATGGGGATGG + Intronic
1121720926 14:96108210-96108232 ATGCATGATGGGAATGGAGAGGG + Intergenic
1124064676 15:26330685-26330707 ATGTTCAATAGGAATGGTGAGGG - Intergenic
1124465449 15:29935584-29935606 TTGTGCTATAGGAATGGGGCAGG - Intronic
1125056783 15:35368582-35368604 ATGAGAGATAAGCATGGGGATGG + Intronic
1125096253 15:35855764-35855786 ATGTGTGAAAATAATGGGTAGGG - Intergenic
1126340390 15:47634897-47634919 ATGTCTGACTGGAATGTGGAAGG + Intronic
1126938411 15:53737993-53738015 ATATGTTACAGGAGTGGGGAAGG - Intronic
1128055426 15:64695898-64695920 AAGTGAGAAAGGAAGGGGGATGG + Intronic
1128981859 15:72194021-72194043 ATGTGGGAAAGGAAGGAGGAGGG - Intronic
1129174972 15:73833285-73833307 ATCTGTGATAGGAGTGAAGATGG - Intergenic
1129192389 15:73945051-73945073 ATGTGTGGTAGGAACAGGAAGGG - Intronic
1129687445 15:77694849-77694871 CTGTCTGGTAGGAAAGGGGAAGG - Intronic
1130438473 15:83926300-83926322 AGATGAGATAGGAATGGGCAAGG + Intronic
1130835514 15:87646032-87646054 AAGTGAGCTAGGAAAGGGGAGGG - Intergenic
1130860840 15:87888129-87888151 ATGTGTGATAGGTCAGGGAAAGG - Intronic
1130897574 15:88183024-88183046 ATGTGTGTTAGGACTGGCGGGGG - Intronic
1131010397 15:89012686-89012708 CTGGGTGGTAGGAATGGGGTTGG + Intergenic
1131058786 15:89391830-89391852 CTGGGAGGTAGGAATGGGGAGGG - Intergenic
1131881340 15:96865981-96866003 ATGTGTGCTTGGGATGGAGAAGG + Intergenic
1132118979 15:99160040-99160062 ATGTGAGGGGGGAATGGGGAGGG + Intronic
1132711615 16:1271414-1271436 ATGGGTGATGGGCCTGGGGACGG + Intergenic
1133502478 16:6379042-6379064 TTGTGTGTTAGGACTGAGGAAGG + Intronic
1133611529 16:7438270-7438292 ATGTTTGCCAGGGATGGGGATGG + Intronic
1133825915 16:9278114-9278136 GTGTGTGGTAGAAATGGAGAAGG + Intergenic
1133844837 16:9444082-9444104 GTGTGTGAAGGGAATGAGGAAGG - Intergenic
1133971711 16:10572913-10572935 ATTTGTCTTTGGAATGGGGATGG - Intronic
1134350759 16:13435854-13435876 TTGTGTGGTAGGAAAGGTGAGGG + Intergenic
1135114226 16:19712021-19712043 ATGAGTGATGGGAATGGAGAGGG - Intronic
1136165007 16:28447963-28447985 AAGTGAGAGAGGAAGGGGGAGGG - Intergenic
1136197960 16:28667017-28667039 AAGTGGGAGAGGAAGGGGGAGGG + Intergenic
1136214305 16:28781194-28781216 AAGTGAGAGAGGAAGGGGGAGGG + Intergenic
1136259027 16:29061039-29061061 AAGTGGGAGAGGAAGGGGGAGGG + Intergenic
1137293275 16:47066697-47066719 ATGAGTGATAGGAATTAGAAGGG - Intergenic
1137455352 16:48613798-48613820 ATGGGAGAATGGAATGGGGAAGG - Intronic
1137560412 16:49498673-49498695 AAGTGTGGGAGGAAAGGGGAAGG - Intronic
1137635063 16:49978621-49978643 GTGTGTGATAGTAATGATGATGG - Intergenic
1138261135 16:55623526-55623548 GTGTGGAATGGGAATGGGGAAGG - Intergenic
1140998813 16:80288550-80288572 ATGTGTGGCAGGAATTGGGAGGG - Intergenic
1141148878 16:81550829-81550851 GTGTGTGATGGAACTGGGGAGGG - Intronic
1143612636 17:8028420-8028442 ATGTGGGCTGAGAATGGGGAAGG + Intergenic
1143725517 17:8842487-8842509 TTGTGTGACAGAAATGGAGAGGG - Intronic
1143832001 17:9659999-9660021 CTTTGGGATGGGAATGGGGATGG + Intronic
1143853909 17:9834398-9834420 ATCTGTTAAAGGAATGGGGGTGG + Intronic
1143894543 17:10125899-10125921 GTCTGTGATAGGAATCGGGGCGG - Intronic
1144336659 17:14277667-14277689 ATGTGTGCTATGAAGGGGCAGGG + Intergenic
1147364491 17:39951394-39951416 ATGTGGAATAGGGATTGGGAGGG - Intergenic
1147969062 17:44210108-44210130 ATATGAGGTAGGAATGGGGCTGG - Exonic
1148683249 17:49486555-49486577 ATCTGTGATAGAAAGAGGGAGGG + Intergenic
1148856085 17:50580030-50580052 ATGTGTGATGGTGATGGGGAGGG - Intronic
1149071142 17:52544763-52544785 GTGTGTGAAAGGAAGGAGGATGG - Intergenic
1149284351 17:55145565-55145587 ATGTGTGATGGACATGTGGATGG - Intronic
1149288915 17:55196684-55196706 CTATGTGCTAGGAATGGTGATGG - Intergenic
1150478619 17:65492386-65492408 ATGTGTGATGGGGAAGGGAATGG - Intergenic
1151374721 17:73679357-73679379 TTCTGGGATAGGAATGGGAATGG - Intergenic
1151376482 17:73692299-73692321 GTGTGTGGTGGGGATGGGGATGG - Intergenic
1151381602 17:73729654-73729676 ATGGGTGATAGGAAGGGGACGGG - Intergenic
1151904178 17:77036866-77036888 CTGGGTGCTAGGAATGTGGACGG - Intergenic
1152157990 17:78647512-78647534 ATGTGTGTTGGGGAAGGGGAGGG + Intergenic
1153196090 18:2597903-2597925 TTGTGAGACAGGAATGGGGATGG + Intronic
1156548562 18:37990455-37990477 ATGTGTGATACTAATGGAAAAGG - Intergenic
1157522804 18:48356897-48356919 ATGTGTGTTAGGAACTGTGAGGG - Intronic
1157713807 18:49868676-49868698 ATGAGTGGTAGGGATGGTGAGGG - Intronic
1158212470 18:55066690-55066712 ATGTGGAACAGGAATGGAGAAGG - Intergenic
1158565394 18:58550539-58550561 ATATATGATAGAGATGGGGATGG - Intronic
1159970256 18:74642396-74642418 ATGAGTTATAGGAAAGGAGAAGG + Intronic
1160298737 18:77659665-77659687 ATGGCTGGAAGGAATGGGGATGG + Intergenic
1161329806 19:3681129-3681151 ATGTGGGATGGGAGTGGGGGCGG + Intronic
1162199134 19:9008623-9008645 AGGGGTGATGGGGATGGGGAGGG + Intergenic
1162863064 19:13522793-13522815 ATGGGTTATAGGAATTGGGTGGG + Intronic
1163013390 19:14439447-14439469 ATATGTGGTAGGCATGGGAATGG + Intronic
1163626001 19:18390101-18390123 ATCTCTGAGAGGAATGGCGATGG + Intergenic
1164565098 19:29320162-29320184 ATGTGTGTGTGGGATGGGGATGG - Intergenic
1164601539 19:29566537-29566559 AGGTGTGATAGGCATAGGGGAGG + Intergenic
1164607297 19:29609370-29609392 CTGTGGGAGAGCAATGGGGATGG - Intronic
1165161162 19:33817297-33817319 ATGTGTGATGAGAATGTGGGTGG + Intergenic
1165249537 19:34518497-34518519 ATGTTGGATAGCAATGGTGAAGG + Intergenic
925076350 2:1019460-1019482 AGGTGTGCTGGGAATGTGGAGGG + Intronic
925801741 2:7608587-7608609 GTCTGTGATAGGATTGGGGATGG - Intergenic
925935596 2:8755842-8755864 ATGTGTCACAGGCATGAGGATGG - Intronic
926611720 2:14954288-14954310 ATGAGTGTTAGGTAGGGGGAAGG + Intergenic
928338973 2:30425010-30425032 ATGCGTGATGTGAAAGGGGAGGG - Intergenic
928576596 2:32661802-32661824 ATGTTGAATAGGAATGGTGAGGG + Intronic
928989338 2:37215871-37215893 CTGGGTGATGGTAATGGGGAGGG + Intronic
930084025 2:47480134-47480156 ATGGGGGATGGGAAGGGGGAGGG - Intronic
932695200 2:73950554-73950576 AAGTGGGATGGGAATGGGGAGGG - Intronic
933241555 2:79927062-79927084 ATTTGTTATAGGAATGTGTATGG + Intronic
933286918 2:80394605-80394627 ATGGGTGGCAGGAATTGGGATGG + Intronic
934659005 2:96133239-96133261 ATGTGGGAAAGGGATGGGAACGG - Intronic
936528751 2:113260373-113260395 GTGTGTGTTGGGGATGGGGATGG + Intronic
937121270 2:119441458-119441480 AGGGGTGGTAGGAAGGGGGATGG - Intronic
938579631 2:132634447-132634469 ATCTGTGATAGGCATAAGGAGGG + Intronic
939041951 2:137200611-137200633 ATGTGTGACTGGGATGGGGCAGG - Intronic
939918717 2:148081782-148081804 ATGTAGAATAAGAATGGGGAAGG - Intronic
941003232 2:160222524-160222546 ATGTGGGTGAGGAAGGGGGATGG - Intronic
941347151 2:164384314-164384336 ATGTGTAAAAGGTATGGTGATGG - Intergenic
941851810 2:170190920-170190942 AACTGTGGTAGCAATGGGGAGGG - Intronic
942151707 2:173082365-173082387 AAGGGTGAAAGGAATGGGGATGG - Intronic
943816544 2:192264360-192264382 ATGTGAGATAGGAAGAGTGAGGG - Intergenic
944275740 2:197835468-197835490 ATGGTTGCCAGGAATGGGGAGGG - Intronic
945026329 2:205623307-205623329 ATGTGTGTGTGTAATGGGGACGG - Intergenic
945385232 2:209190436-209190458 AAGTGTTATGGGAATGTGGAAGG - Intergenic
946823438 2:223653212-223653234 ATCAGTGAAAGAAATGGGGAAGG + Intergenic
946980434 2:225208078-225208100 ATGTGTAATATGAATGGAAAAGG + Intergenic
1170428438 20:16257863-16257885 GTGTGTGTTTGGGATGGGGAAGG - Intergenic
1170428446 20:16257889-16257911 GTGTGTGTTTGGGATGGGGAAGG - Intergenic
1170428454 20:16257915-16257937 GTGTGTGTTTGGGATGGGGAAGG - Intergenic
1170428492 20:16258094-16258116 GTGTGTGTTTGGCATGGGGAAGG - Intergenic
1170428526 20:16258226-16258248 GTGTGTGTTTGGGATGGGGAAGG - Intergenic
1170428541 20:16258277-16258299 GTGTGTGTTTGGGATGGGGAAGG - Intergenic
1170428563 20:16258382-16258404 GTGTGTGTTTGGGATGGGGAAGG - Intergenic
1170428635 20:16258668-16258690 ATGTGTGTTTGGGATGGGGAAGG - Intergenic
1170428678 20:16258848-16258870 GTGTGTGTTTGGGATGGGGAAGG - Intergenic
1170428734 20:16259050-16259072 GTGTGTGTTTGGGATGGGGAAGG - Intergenic
1170428742 20:16259076-16259098 GTGTGTGTTTGGGATGGGGAAGG - Intergenic
1170428765 20:16259154-16259176 GTGTGTGTTTGGGATGGGGAAGG - Intergenic
1170428773 20:16259180-16259202 GTGTGTGTTTGGGATGGGGAAGG - Intergenic
1171330377 20:24332193-24332215 ATGTGGGAGGGGAATGGTGATGG + Intergenic
1172169040 20:32917822-32917844 ATGTGTAGTAGCAATGGGAAAGG - Intronic
1172221325 20:33276955-33276977 AGGTGAGATGGGATTGGGGATGG - Intronic
1172967235 20:38845630-38845652 ATGTGTGATGGGAACAGGGTTGG + Intronic
1173122566 20:40307262-40307284 AGGTGTGATGGGAACTGGGAAGG - Intergenic
1174694908 20:52547353-52547375 ATGTTGAATAGGAATGGTGAGGG - Intergenic
1175423136 20:58848437-58848459 ATATGTGATAGGACTGAGGAAGG - Intronic
1177346556 21:19879972-19879994 ATATGTTACAGGAATGGGGGCGG - Intergenic
1178900704 21:36596278-36596300 GTGTGTGATGGGGGTGGGGAGGG - Intergenic
1179370793 21:40804519-40804541 AGGTGTGCTGGGAACGGGGAGGG - Intronic
1180239100 21:46487452-46487474 ATGTGTAATAAGAATGGGCATGG - Intronic
1181580619 22:23826052-23826074 CTCTGTGGTAGGGATGGGGATGG + Intronic
1182148160 22:28010291-28010313 AGGGGTGCTAGGAAGGGGGAAGG - Intronic
950115961 3:10450495-10450517 AGGTCTCATAGGCATGGGGATGG + Intronic
951531969 3:23706371-23706393 ATGAGTAATAGGTATGGGGGCGG - Intergenic
952651941 3:35737692-35737714 ATCTGTGACGGGAATGGGGGAGG - Intronic
952983369 3:38756278-38756300 TTCTGGGATAGGTATGGGGAGGG + Intronic
953885553 3:46712715-46712737 ATGGGGGCTGGGAATGGGGATGG - Intronic
958126561 3:89363912-89363934 ATTTGAGATAGGAATAGGGGAGG - Intronic
959830492 3:110855896-110855918 ATTTGTGAGTAGAATGGGGATGG - Intergenic
959894605 3:111592081-111592103 ATGTGGGTTGGGAATGGGGATGG - Intronic
959996810 3:112689200-112689222 AAGTTTGATGGGAATGGAGAAGG + Intergenic
960394800 3:117123424-117123446 ATGTGTGGCTGAAATGGGGAAGG - Intronic
962866411 3:139451371-139451393 GAGAGTGATAGGAGTGGGGATGG + Intergenic
963071268 3:141307426-141307448 ATGTGTGATAGGGATGGAAAAGG - Intergenic
963156722 3:142106823-142106845 AATTGTGATTGGAATGGGAAAGG - Intronic
963301606 3:143603346-143603368 ATGTGAGAGAGGAATGTAGAGGG - Intronic
963587493 3:147211022-147211044 ATTAGTGAAAGGAATGAGGAAGG - Intergenic
963918818 3:150886432-150886454 ATGAGTGAGAGAAATGGGGAGGG + Intronic
964251994 3:154728522-154728544 AAGTGAGAAAGGAAGGGGGAGGG + Intergenic
965392952 3:168127879-168127901 ATGTTTGAGAGGTATGGGGGAGG + Intergenic
966100022 3:176257016-176257038 ATCTGTGAAAAGAATGGGAAGGG - Intergenic
966762735 3:183431596-183431618 ATGGGTGAGAGGAAGGGAGAAGG - Intergenic
967700951 3:192591689-192591711 GTGAGTGACAGGAAAGGGGATGG + Intronic
968278590 3:197458971-197458993 ATGTGAGATAGAAATGAAGATGG - Intergenic
969987263 4:11225268-11225290 ATTTGTGAAAGGAAATGGGAAGG + Intergenic
970947555 4:21712971-21712993 AAGAGTGAAAGAAATGGGGAAGG - Intronic
971408258 4:26342520-26342542 ATGGGAGAAAGGAATGAGGAGGG - Intronic
971473118 4:27048401-27048423 ATATGTGATAACGATGGGGAAGG - Intergenic
974084198 4:57242179-57242201 CAGTGTGATTGGAATGGGGAAGG + Intergenic
974112873 4:57545513-57545535 ATGTGTGAGAGTGATGGGGAGGG + Intergenic
974687969 4:65256010-65256032 ATTTGTGAAATGATTGGGGAAGG - Intergenic
974937369 4:68424282-68424304 ATGTTTAATAGGAGTGGTGAGGG - Intergenic
974950501 4:68579345-68579367 TTCTGTGATAGGAACGGGGTGGG - Intronic
974958888 4:68674864-68674886 TTCTGTGATAGGAACGGGGTGGG - Intergenic
975650155 4:76584938-76584960 ATGTGGGATAGGAATGGGGTGGG - Intronic
976474629 4:85470303-85470325 ATGTGTGATATGAATGTTCATGG + Intergenic
978025252 4:103865484-103865506 ATGTTTAATAGGAGTGGTGAGGG + Intergenic
978735683 4:112081652-112081674 ATGTGTAATTGGAATTGGGCTGG - Intergenic
979890143 4:126082127-126082149 ATGTATGATATGATTGTGGAAGG + Intergenic
980132814 4:128832544-128832566 ATGTGTGATGGGAAAGGAGCTGG + Intronic
980497510 4:133605184-133605206 ATATGAGATAGGAATTGAGAAGG - Intergenic
982545687 4:156730121-156730143 ATATTTGATGGGAATGAGGAAGG - Intergenic
983387075 4:167078387-167078409 ATGTTGGGAAGGAATGGGGACGG + Intronic
984753199 4:183298544-183298566 GTGAGGGAAAGGAATGGGGAAGG - Intronic
986252044 5:6068975-6068997 ATGTCCCATAGGAATGAGGATGG + Intergenic
986624694 5:9712788-9712810 ATGTATGAAAGGAATGTGGGAGG + Intergenic
987199617 5:15562730-15562752 ATGTGTGAAAGAAAGAGGGAAGG - Intronic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
987466733 5:18280694-18280716 AGGTGTGATGGGAACCGGGATGG + Intergenic
987910167 5:24132486-24132508 AGGTGGGAGAGGGATGGGGAGGG + Intronic
989232681 5:39103996-39104018 ATGTGTGAGAGAAAATGGGAAGG + Intergenic
990174763 5:53095146-53095168 ATGTGTGCTTGGAATAGAGAGGG + Intergenic
990408457 5:55516003-55516025 TGGTTTGATAGGAAGGGGGATGG - Intronic
990522817 5:56595912-56595934 ATCTGTGACAGGCTTGGGGAAGG + Intronic
991086075 5:62649371-62649393 ATGGGTGATGGGAGTGGGGCGGG + Intergenic
992027409 5:72684179-72684201 ATGTGTGTTTGGAATGGGCTTGG - Intergenic
992496679 5:77300666-77300688 ATGTGTGTTAGCAAAGAGGAGGG + Intronic
992502555 5:77356852-77356874 ATCTGTGATAGGATTTGGCAGGG - Intronic
993133299 5:83926168-83926190 ATGTGTGATAGGAAGGGAGAGGG + Intergenic
993158196 5:84254778-84254800 ATGAGTGAAAGAAATGTGGAAGG + Intronic
994203586 5:97007002-97007024 AACTATGATAGGAAGGGGGAGGG + Intronic
997183879 5:131861491-131861513 ATGTTTAATGGGCATGGGGAAGG + Intronic
998050371 5:139027621-139027643 ATATGTGAGTGGAGTGGGGAAGG - Intronic
998365631 5:141629009-141629031 ATGTAACAGAGGAATGGGGAAGG + Intronic
998922583 5:147085816-147085838 ATTTGCAATAGGAATGAGGAAGG + Intergenic
1001264071 5:170259701-170259723 GTGTGTGATAGGATTGATGATGG - Intronic
1001272946 5:170329384-170329406 ATTTGGGATAGAAATGAGGAAGG - Intergenic
1001332580 5:170772699-170772721 GTGTGTGATGGGTGTGGGGAAGG + Intronic
1003011884 6:2434251-2434273 CTGTGTCATGGGAATGAGGAAGG + Intergenic
1003274787 6:4640249-4640271 ATGTGTGGTATGCATGGGCAGGG - Intergenic
1003904456 6:10686392-10686414 AAGTGGGAAGGGAATGGGGAAGG + Intronic
1004313096 6:14563259-14563281 ATGTGTGTGTGGAGTGGGGAAGG + Intergenic
1004776153 6:18847398-18847420 ATCTGTTATAGGAATAGGGATGG + Intergenic
1005640894 6:27795080-27795102 GTGTGTGGCAGGAATGGTGATGG + Intergenic
1005862531 6:29912450-29912472 AGCTGAGATAAGAATGGGGAAGG - Intergenic
1007262007 6:40570536-40570558 ATGTGGGGCAGGAATGGGGAAGG - Intronic
1008975292 6:57419064-57419086 ATGTGTGATTGTAGTGGTGATGG + Intronic
1008979638 6:57468163-57468185 ATGTTGAATAGGAATGGTGAGGG + Intronic
1009164171 6:60320577-60320599 ATGTGTGATTGTAGTGGTGATGG + Intergenic
1009198203 6:60712317-60712339 ATGTGTGGTAGGAATAAAGAAGG + Intergenic
1009458593 6:63886703-63886725 ATGTGTGATAGGCACAGTGAAGG - Intronic
1009937357 6:70249595-70249617 ATTTGTGATAGGAAATGTGATGG + Intronic
1010085683 6:71915263-71915285 ATATGTGACAGAATTGGGGAAGG - Intronic
1010493504 6:76503387-76503409 ATGGGGGATAGGCAGGGGGAGGG - Intergenic
1010849239 6:80751095-80751117 ATTTTTGACAGGAATGGGGGTGG - Intergenic
1011266996 6:85532413-85532435 ATGAGACATAGGAATTGGGAGGG - Intronic
1011371428 6:86640986-86641008 ATGTGTGCTGGGAAGGTGGAGGG + Intergenic
1012212080 6:96531608-96531630 CTGGGTGGTAGGAATGGAGAGGG + Intronic
1013170660 6:107634457-107634479 GTGAGGGATAGGGATGGGGATGG - Exonic
1016360382 6:143261088-143261110 ATGTTGCAGAGGAATGGGGAAGG + Intronic
1016983553 6:149876320-149876342 ATAGGTGATAGGAAAGGGGTAGG + Intergenic
1017085244 6:150707489-150707511 AGGTGTAATATGAAAGGGGATGG + Intronic
1020382301 7:7560099-7560121 ATGTTGGATAGGAGTGGTGATGG - Intergenic
1020671196 7:11115089-11115111 ATGTGAGATAAGGATGGGGAAGG - Intronic
1023344846 7:39260967-39260989 GTGTGTGATATGAATGGTGGTGG - Intronic
1026284890 7:68954619-68954641 ATGTGTGGGAAGAATGGAGAGGG + Intergenic
1028055604 7:86238278-86238300 AAATGTGGTAGTAATGGGGATGG + Intergenic
1028733996 7:94186082-94186104 ATGTTGAATAGGAATGGTGAGGG + Intergenic
1028763012 7:94516639-94516661 ATATGTCAAAGGAATGGGGTGGG - Intronic
1028997192 7:97114187-97114209 AAGTGAGAAAGGAGTGGGGAGGG - Intergenic
1029358790 7:100072963-100072985 ATGTGTGTTAGGGACGGGAACGG + Intronic
1030787201 7:113676450-113676472 ATGTCTGACAGGAAGAGGGATGG - Intergenic
1032414517 7:131725999-131726021 ATGTGTGTGAGGCATGGGAAGGG + Intergenic
1032467885 7:132158002-132158024 ATGTGTGATGGTGGTGGGGAGGG - Intronic
1033014251 7:137655832-137655854 AAGTGTGAAAGGAAAGAGGATGG + Intronic
1033101865 7:138480342-138480364 TTGTGTGAAAGGAATGGTGCTGG + Intronic
1035649973 8:1256941-1256963 CTGTGTGAAAGGAATGGGGCAGG - Intergenic
1037929108 8:22867018-22867040 CTGTGTGATAGGAACGAAGAGGG + Intronic
1038397506 8:27257899-27257921 ATGTGTGATCAAAATGGGAATGG + Intronic
1039024032 8:33238307-33238329 AGGAGTGATGGGAAGGGGGAGGG + Intergenic
1039028305 8:33282341-33282363 TTGGGTGATAGGAATGGAGGTGG - Intergenic
1039521171 8:38173357-38173379 AAGAGTGATAGGAAGGGGGCGGG + Intronic
1040859751 8:51986873-51986895 AGGTGTGATAGAAATGAGAAGGG - Intergenic
1041672787 8:60509653-60509675 ATTTGGGATTGGAATGGGAATGG - Intergenic
1042140748 8:65676142-65676164 GTGTGTGTTGGGAAGGGGGAAGG - Intronic
1043187662 8:77175075-77175097 ATGACTGATACAAATGGGGAAGG - Intergenic
1043800260 8:84600682-84600704 ATGACTGAGAGGAATGAGGAGGG + Intronic
1044299238 8:90564663-90564685 ATGTGTGATCTGAACGTGGAGGG + Intergenic
1044642929 8:94404072-94404094 ATGTGTAATGGGAATGAGGTAGG - Exonic
1044745579 8:95367473-95367495 ATGTGTGATAGGTCAGGGAAAGG + Intergenic
1045913602 8:107439939-107439961 GTGGGTAATTGGAATGGGGAGGG + Intronic
1046259933 8:111754675-111754697 ATGAGTGACAGGAATGAGGCTGG - Intergenic
1047487715 8:125347319-125347341 AGGTGTGATAAGAAGAGGGAAGG - Intronic
1048524421 8:135188170-135188192 ATGTGTGCCAGGCATGGGGCTGG + Intergenic
1049120630 8:140733820-140733842 GTGTGTGAGAGTTATGGGGACGG + Intronic
1049667231 8:143851054-143851076 ATTTGTGATAGGATTGGTGATGG - Intergenic
1050089300 9:2000711-2000733 ATGGGTGATAGGAGTAGGGATGG - Intergenic
1050615958 9:7402050-7402072 GTGTGTGTTGGGAAAGGGGATGG - Intergenic
1050685105 9:8159597-8159619 ATATGTGAAATGAGTGGGGAAGG + Intergenic
1052325409 9:27212463-27212485 AGGTTTGGTAGGAATGGAGAGGG + Intronic
1054155519 9:61637220-61637242 ATGTATGATATGAAGGGGAAAGG + Intergenic
1054849423 9:69831560-69831582 CTGTGAGATAGGAGTGGGGAGGG + Intronic
1056877227 9:90345485-90345507 ATGTGTGGTAGCGATGGGGAGGG + Intergenic
1057025419 9:91731332-91731354 ATCAGGGATAGGCATGGGGAAGG + Intronic
1057951579 9:99373302-99373324 CTGTGAGATAAAAATGGGGAGGG - Intergenic
1058001218 9:99867917-99867939 AGGTGTGGTTTGAATGGGGAGGG + Intergenic
1059528236 9:115013026-115013048 ATGAGTACTGGGAATGGGGAGGG + Intergenic
1059621308 9:116008575-116008597 ATGTGTGGGATGAATGGAGAAGG + Intergenic
1060160309 9:121356602-121356624 AGGTGAGAAAGGAATGGGGCGGG + Intronic
1060587552 9:124795902-124795924 ATGTGCTATAGGACTGGGCAGGG + Intronic
1061748091 9:132754680-132754702 ATGTGTGATAGGCATGGCTAGGG - Intronic
1062141397 9:134961049-134961071 GTGTGTGATGGGAGAGGGGAGGG + Intergenic
1062365030 9:136204412-136204434 GTGTGTGGCAGGACTGGGGAAGG + Intronic
1062628919 9:137454971-137454993 CTGTGTGATTGGAGTGGGGGAGG + Intronic
1186728824 X:12385948-12385970 ATGTGTGATAGGACTGTCAAAGG - Intronic
1187097985 X:16167177-16167199 TGGTGTGACAGGAGTGGGGATGG - Intergenic
1189028881 X:37429122-37429144 ATCTGTGATAGGGGTGGGTAGGG + Intronic
1189578978 X:42385648-42385670 ATCTGTGACAGGAATAGGGAGGG - Intergenic
1189960697 X:46322397-46322419 GTGTTTCATAGAAATGGGGATGG + Intergenic
1192252609 X:69425318-69425340 ATGTGTGCTATGAATGAGAAAGG + Intergenic
1192717288 X:73657653-73657675 ATGTTGAATAGGAATGGTGAGGG + Intronic
1194861769 X:99007657-99007679 ATGTTTGATATGAATGGAGTTGG - Intergenic
1195254388 X:103078770-103078792 GGATGTGGTAGGAATGGGGAGGG + Intronic
1197523051 X:127523601-127523623 ATGTTGAATAGGAATGGTGAGGG - Intergenic
1198458902 X:136844897-136844919 ATATGTTTTAGGAGTGGGGAGGG - Intergenic
1198478858 X:137022432-137022454 ATGGGAGATTGGAATGAGGAGGG + Intergenic
1199872556 X:151912602-151912624 GTGGGGGATAGGAATGGGGGTGG - Intronic
1201916813 Y:19190863-19190885 CTGTGTGATAGCAATGAGCAAGG + Intergenic