ID: 916531157

View in Genome Browser
Species Human (GRCh38)
Location 1:165657934-165657956
Sequence CAAGCTAGTCCCTTGTCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916531156_916531157 12 Left 916531156 1:165657899-165657921 CCAGTTGGTAAAGACTGCTTAGA 0: 1
1: 0
2: 1
3: 11
4: 99
Right 916531157 1:165657934-165657956 CAAGCTAGTCCCTTGTCTTGTGG 0: 1
1: 0
2: 0
3: 4
4: 93
916531154_916531157 30 Left 916531154 1:165657881-165657903 CCTAGGGCTTGGCAGAATCCAGT 0: 1
1: 0
2: 2
3: 11
4: 163
Right 916531157 1:165657934-165657956 CAAGCTAGTCCCTTGTCTTGTGG 0: 1
1: 0
2: 0
3: 4
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916531157 Original CRISPR CAAGCTAGTCCCTTGTCTTG TGG Intronic
905913151 1:41667543-41667565 CTTGCAAGTCCCTTGGCTTGGGG - Intronic
906758900 1:48352871-48352893 GAAGCTAATCCATTGTCTTCTGG - Intronic
907932688 1:59015263-59015285 CATGCTGGTCCCTTGACTTAGGG + Intergenic
908485134 1:64584293-64584315 CAAGGTAATTCTTTGTCTTGGGG - Intronic
912245184 1:107954634-107954656 CAAGCTATTCTCCTGTCCTGAGG + Intronic
915492333 1:156257992-156258014 CAAGACAGTCCTTTCTCTTGTGG - Intronic
916531157 1:165657934-165657956 CAAGCTAGTCCCTTGTCTTGTGG + Intronic
918136352 1:181677602-181677624 AAACCTGGTCCTTTGTCTTGGGG + Intronic
922812400 1:228424803-228424825 CAAGCTAGTCTCTTGGGTTTCGG - Intergenic
923424172 1:233852409-233852431 AGATCTAGTCCCTTGTGTTGTGG - Intergenic
1069995807 10:72341399-72341421 AAAGCTTGACCATTGTCTTGAGG - Intronic
1070806515 10:79274095-79274117 CCAGCCTGTCCCTTGTCCTGTGG - Intronic
1075396496 10:122131628-122131650 CCACATAGTCCTTTGTCTTGGGG + Intronic
1076205735 10:128600127-128600149 AAATATAGACCCTTGTCTTGAGG + Intergenic
1079953780 11:26837499-26837521 GACGCTAGTCTCTTGTCATGGGG + Intergenic
1082105970 11:48222242-48222264 CACGCTAGTCCCTAGCCATGTGG + Intergenic
1083869138 11:65476487-65476509 CAACCTGGGCTCTTGTCTTGAGG + Intergenic
1085005835 11:73088943-73088965 AAAGCTATTCCTTTTTCTTGTGG - Intronic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1095518536 12:43034658-43034680 CAATCTTTTCCCTTGTCTTCTGG + Intergenic
1100984763 12:100193236-100193258 CAAGATAGTCCCTGTCCTTGTGG - Intergenic
1101244928 12:102876338-102876360 CTAGCTAGGCCTTTGTCTTCAGG + Intronic
1110394998 13:75019514-75019536 CAAGCTAGTTCTTTGTCTGTTGG - Intergenic
1112210347 13:97370787-97370809 AAAGTTAGTCCTTTGTCTTAGGG + Intronic
1119609432 14:76049138-76049160 GAAGTTTGTCCCTTGACTTGTGG + Intronic
1122313521 14:100812322-100812344 CAAGCTGGTCACTTCCCTTGGGG + Intergenic
1124989681 15:34659331-34659353 CAAGCTGGTTCCTTGTCTGTTGG - Intergenic
1125430000 15:39584064-39584086 CTTGCAAGTCCTTTGTCTTGTGG - Exonic
1126179296 15:45769132-45769154 CAAGCTTGTACCATCTCTTGGGG + Intergenic
1126353695 15:47771856-47771878 CAAGCGAGTCTCTTGTTTTAAGG - Exonic
1128203145 15:65827350-65827372 CAACCTAGTCTCCTTTCTTGGGG + Intronic
1128267721 15:66281172-66281194 CAAGGTAGTGCCTTACCTTGGGG - Intergenic
1129736270 15:77966700-77966722 CAAGCTAGTGCCAGTTCTTGTGG + Intergenic
1130799281 15:87244834-87244856 CATTCTGGTCCCTTGTCTTATGG - Intergenic
1134837235 16:17371249-17371271 GAAGATAGTCCCTGGTCCTGGGG - Intronic
1137657085 16:50169610-50169632 CAAGCTACTTGGTTGTCTTGAGG + Intronic
1137696178 16:50463626-50463648 CAAGCCAGTCCCTTCCCCTGGGG - Intergenic
1138390306 16:56665682-56665704 CAAGTTAGTCCCTCCACTTGTGG - Intronic
1138679684 16:58675902-58675924 CACTCTAGTCCCAGGTCTTGGGG + Intronic
1143509745 17:7388886-7388908 AAAGCCAGCCCCTTCTCTTGGGG + Intronic
1145256719 17:21328596-21328618 CATACTAGTCCCTTGTCTTCTGG + Intergenic
1145319894 17:21759352-21759374 CATACTAGTCCCTTGTCTTCTGG - Intergenic
1145832431 17:27927527-27927549 CAAGCTAGTCCCTTGTGGCAAGG - Intergenic
1152893626 17:82896939-82896961 CAAGCTTGGCCATTGTCATGGGG + Intronic
1156539041 18:37891979-37892001 CAAGCTAGTCCAAGGTGTTGTGG + Intergenic
1160012640 18:75117492-75117514 CAAGCTAGTCGTTTCACTTGGGG + Intergenic
1163281298 19:16319676-16319698 CAAGGGAGGCCCCTGTCTTGAGG + Intergenic
1163625959 19:18389842-18389864 CAACCAAGTGCCTTGTTTTGTGG + Intergenic
936920714 2:117685886-117685908 CATGGTTGTCCCTTGTCTTCAGG + Intergenic
937633506 2:124129686-124129708 CAATCTAATACCTTGTGTTGGGG - Intronic
941118150 2:161495709-161495731 AAAGTTAGTTTCTTGTCTTGAGG - Intronic
943767207 2:191676153-191676175 CAACCTAATCCCTTTTCTGGGGG + Intergenic
945524817 2:210875011-210875033 TAAGCTAGACCCTTGTCTCAGGG - Intergenic
945579651 2:211577397-211577419 TAATCAAGTACCTTGTCTTGCGG + Intronic
947848057 2:233261516-233261538 CAAACTAATACCTTATCTTGAGG - Intronic
1170048529 20:12113705-12113727 CATGCTAGGTCCTTGTCGTGTGG + Intergenic
1172160719 20:32866269-32866291 CAATTTAATCCCTTGTCTTTTGG + Intronic
1172965236 20:38829714-38829736 CAGGCCAGTGCCCTGTCTTGGGG + Intronic
1172965492 20:38831365-38831387 CAGGCCAGTGCCCTGTCTTGGGG + Intronic
1173809019 20:45945109-45945131 CAAACCAGTCCCTGGCCTTGAGG - Intronic
1181421394 22:22801524-22801546 CAGGCCAGTTCCTTTTCTTGTGG - Intronic
1183382489 22:37497107-37497129 CCATCTGGTCCCTTGTCCTGCGG + Exonic
1185219844 22:49623811-49623833 CAAGCTGGTCCCATGCCTGGGGG + Intronic
950570241 3:13795425-13795447 CCAGCTACTCCCTTGTCTAATGG + Intergenic
953870238 3:46619839-46619861 CAAGCTGTTCCCTTGCCTCGGGG - Intronic
956284684 3:67596244-67596266 AAAGCTAGTTACTTGTGTTGAGG - Intronic
960637317 3:119796336-119796358 CTTGCAAGTCCCCTGTCTTGGGG - Intronic
970469587 4:16363523-16363545 AAAGCTAGCCCACTGTCTTGAGG - Intergenic
971783899 4:31075609-31075631 GAAGCTAGGCCCATGTCTTGAGG - Intronic
973823726 4:54684956-54684978 CAACCTACTACCTTGTCCTGAGG + Intronic
975537951 4:75471812-75471834 CAAGTTATTCCCTTGTCTGATGG - Intergenic
991156493 5:63442701-63442723 CAGGCTAGTCTCTTATCTGGCGG + Intergenic
1003246072 6:4383354-4383376 CAAGCTATCCTCTTGCCTTGAGG - Intergenic
1003410057 6:5854262-5854284 CAAGCTAGTCCTAGGTCTTTGGG - Intergenic
1004025800 6:11817358-11817380 GAAGCTGGTCCCTTTGCTTGGGG - Intergenic
1014810782 6:125883192-125883214 CAAGATAGTCCCTTCTCCAGAGG - Intronic
1015127621 6:129771847-129771869 CATGCTAGTCTGTTGTTTTGTGG - Intergenic
1016899525 6:149087968-149087990 CAAGCCAGACCCTTAGCTTGTGG + Intergenic
1017776933 6:157688004-157688026 GAAGCTACTTCCTTGTCATGTGG - Intergenic
1018975029 6:168558078-168558100 GAAGCCAGTCCCTTGCCTGGTGG - Intronic
1021777654 7:24069163-24069185 CAGGCTAGTCTCTTGCCTAGTGG + Intergenic
1027128065 7:75571345-75571367 GCAGCTGGTCCCTTCTCTTGGGG + Intronic
1031230990 7:119106086-119106108 CAAGCCAGCCCCTATTCTTGAGG + Intergenic
1031315199 7:120248330-120248352 AAAGCTATTCCATTGTCTTTTGG - Intergenic
1033890521 7:146007156-146007178 TAACCTATTCCCTTGCCTTGTGG + Intergenic
1034184668 7:149165920-149165942 AAAGCTGGTACCTTTTCTTGAGG - Intronic
1034922289 7:155093761-155093783 CAGGCTACTCACATGTCTTGTGG + Intergenic
1038364832 8:26920372-26920394 CTAGATAATTCCTTGTCTTGAGG - Intergenic
1046983541 8:120362511-120362533 CAAGCAAGTCCCTGATTTTGTGG + Intronic
1055466450 9:76571293-76571315 CAATCTACTCCCTTATCTTGGGG - Intergenic
1056950856 9:91039785-91039807 CAGCCTTGTCCCTTCTCTTGGGG - Intergenic
1059096570 9:111422525-111422547 CAACCTTGTCCCTTGTCTGTTGG - Intronic
1059411061 9:114132593-114132615 CAGGTTTGCCCCTTGTCTTGGGG - Intergenic
1061405063 9:130389093-130389115 GGAGCTGGTCCCTTGTCTGGTGG + Intronic
1186663472 X:11693818-11693840 CAATCTAGTCTCTTTTTTTGAGG + Intergenic
1187108382 X:16269231-16269253 CATGTTGGTTCCTTGTCTTGTGG - Intergenic
1194332673 X:92602176-92602198 CAAATGAGTCCCTTCTCTTGAGG - Intronic
1200641368 Y:5721221-5721243 CAAATGAGTCCCTTCTCTTGAGG - Intronic