ID: 916532598

View in Genome Browser
Species Human (GRCh38)
Location 1:165672033-165672055
Sequence CACTGTACTGTGCCCTACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916532598 Original CRISPR CACTGTACTGTGCCCTACAA TGG (reversed) Intronic
906096440 1:43227390-43227412 CGGTGTACTGTGCCCTCCTAAGG + Intronic
907668478 1:56453457-56453479 CTCTGTACTGTCCTCTACCAGGG + Intergenic
911706468 1:101019404-101019426 CACTGAACTGTACACTAAAATGG + Intronic
916084801 1:161260605-161260627 CCCTGTAGTGTGTCCTACAAAGG - Intronic
916532598 1:165672033-165672055 CACTGTACTGTGCCCTACAATGG - Intronic
917363268 1:174200836-174200858 CACTGTACTTTATCCTATAAAGG - Intronic
918466663 1:184827707-184827729 CACTGTGGTGTGGCCTTCAAGGG - Intronic
920217754 1:204373591-204373613 CACTGTGGTGTTTCCTACAATGG - Intronic
920412546 1:205773792-205773814 CACGGTACTGGGCCCTACTGGGG + Intronic
920461301 1:206142589-206142611 CACTTTCCTGCGCCCTCCAAGGG - Intergenic
920839033 1:209538308-209538330 CACTGGACTGTGTCCTACTTTGG + Intergenic
922296882 1:224257826-224257848 CACTGCACTGGGCCCGACAAGGG + Intronic
922455744 1:225772067-225772089 CAGTGTACTGTGCCCTGTTATGG + Intergenic
1062860625 10:806606-806628 CAATGTACTGTCCCCTGCAGAGG - Intergenic
1065383714 10:25114351-25114373 CACTGGACTGTGGGCTACCAGGG + Intergenic
1067289931 10:44933167-44933189 CACTGTACTGTGCCTAAGCAAGG + Intronic
1068404200 10:56569124-56569146 CACCGTACTGTTTTCTACAATGG + Intergenic
1070626316 10:78053772-78053794 CAATATACTGTGCCCAACACAGG - Intronic
1070753293 10:78976461-78976483 CACTGCACCCTGCCCTAGAATGG + Intergenic
1072950591 10:99843679-99843701 CACTGTGCTGGACTCTACAAGGG - Intronic
1073381724 10:103082861-103082883 AGCTGTACTGTACCCTACATAGG - Exonic
1075671105 10:124264708-124264730 GACTGTTCTGTGCTCTCCAAGGG - Intergenic
1078911652 11:15738299-15738321 CACTTGGCAGTGCCCTACAAAGG + Intergenic
1079865654 11:25730140-25730162 CACTGTAATTTGCCCTGCAGTGG - Intergenic
1081446445 11:43135674-43135696 CACAGTTCTGGGCTCTACAATGG + Intergenic
1082216455 11:49576293-49576315 CACTGGACTGTGCACTCCCACGG - Intergenic
1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG + Exonic
1086051694 11:82599597-82599619 AACTGTACTCTGCCCTAAGAAGG + Intergenic
1086633100 11:89047803-89047825 CACTGGACTGTGCACTCCCACGG + Exonic
1087963471 11:104381657-104381679 CACTGTGCTGAGCCCTAAATGGG - Intergenic
1089536343 11:119162684-119162706 CCTGGTACTGTGCCCTGCAAGGG + Intergenic
1090994795 11:131856074-131856096 CACAGTATTGTGCCCTAGAAGGG - Intronic
1091848143 12:3673445-3673467 AACTGGAGTGTGCCCTAAAAAGG - Exonic
1102002163 12:109563981-109564003 CACTGTTCTGTTCCCTAAGAAGG - Intronic
1103409851 12:120703159-120703181 CACTGAATTCTGCCCTTCAAGGG - Intergenic
1104412870 12:128573814-128573836 CACTGAACTGTACCCTTAAATGG + Intronic
1105391354 13:19981887-19981909 CAGTGTACTGTGACCCTCAACGG - Intronic
1106873808 13:34050195-34050217 CACTGTACTGTTTTCCACAATGG + Intergenic
1110305620 13:73983980-73984002 CACTGTCCTCTCCACTACAAGGG + Intronic
1113137406 13:107107994-107108016 CTCTCTACTGTTCCCTACAGTGG + Intergenic
1114675594 14:24438073-24438095 CACTATAACGTGCCCTATAATGG + Exonic
1118632556 14:67719124-67719146 CTCTGTATTGTACCCTCCAATGG - Intronic
1119778138 14:77260716-77260738 CACTGGGCTGTGCCCAAGAAAGG + Intergenic
1124598405 15:31110717-31110739 CACAGGCCTGTGCCCTCCAATGG - Intronic
1125169641 15:36751563-36751585 CACTGTACTGTCTTCCACAATGG - Intronic
1129782349 15:78281035-78281057 TACTGTTCTGTGCCCTTCAGTGG + Exonic
1130504888 15:84529976-84529998 CACTGAACTGTACACTTCAAAGG + Intergenic
1131484765 15:92810550-92810572 CACTGTCGTGTGCCCTCCATTGG - Intergenic
1131871826 15:96771730-96771752 CACTGCTCTGGGACCTACAATGG + Intergenic
1132630219 16:913680-913702 AACTGTACTGTGCCATTCACAGG + Intronic
1141291049 16:82718337-82718359 CACTCACCTGTGCCCTACAGAGG - Intronic
1141856198 16:86682965-86682987 CACTGTCCTCTGCCCTGCAGTGG - Intergenic
1149381270 17:56096287-56096309 TATTGTCCTGTGCTCTACAATGG + Intergenic
1153590682 18:6671251-6671273 CACTGTTCTGTGACTTACATAGG + Intergenic
1153824101 18:8859036-8859058 CACTGTACTGGGCCCTGAACAGG + Intergenic
1154398696 18:14014114-14014136 CACTGTACTGTAGCCTATTAAGG + Intergenic
1157681913 18:49614012-49614034 CACTGTAATGTGCCCGGGAAGGG + Intergenic
1161165059 19:2782363-2782385 CAGTGTAGTGTGCCCTTCAGAGG - Intronic
1162494132 19:11013762-11013784 CACTGTGCAGTGCCCTGCAAGGG + Intronic
1164428387 19:28165479-28165501 CTCTGGCCTGTGCCCTAGAAAGG + Intergenic
1165893802 19:39129978-39130000 CACTGTACTATAATCTACAAGGG - Intronic
925347952 2:3183580-3183602 CACTGTGCTAGGCCCTGCAAAGG - Intergenic
925855629 2:8126487-8126509 CACTGAACTGTGACCTCCAAGGG + Intergenic
926655162 2:15395973-15395995 CAATGTATTATGCCCTAAAAAGG + Intronic
928135357 2:28683601-28683623 CACAGGACTGTGCCATATAAAGG - Intergenic
930016928 2:46977145-46977167 CACTGTACTGTCCCTGTCAAAGG + Intronic
932946790 2:76243297-76243319 CTCTGTACTGTTCTCTAAAATGG + Intergenic
936444795 2:112587031-112587053 CACTGGACTGTGAGCTCCAAAGG + Intronic
936824224 2:116561190-116561212 CACTGTACTGTACCTGACAGTGG + Intergenic
939738255 2:145876830-145876852 CTATGTACTGTGCCCAACATTGG + Intergenic
944037685 2:195315395-195315417 CATTGAGCTGTGCCCTGCAAAGG - Intergenic
948389219 2:237600070-237600092 CACTGTCCAGTGTCCTTCAACGG + Intronic
948690897 2:239704495-239704517 AACTGCACTCTGGCCTACAAAGG - Intergenic
1172656894 20:36542994-36543016 CAGTGCACTGTGCCCAACAGAGG - Intronic
1173040875 20:39461094-39461116 CACTTCACTCTGCCCTAAAAAGG - Intergenic
1176935339 21:14860659-14860681 CACTGGGCTGTGCCCTAGTAAGG + Intergenic
1180698281 22:17768214-17768236 CACTGAACTGTGCCCTTTGATGG + Intronic
1182356718 22:29725538-29725560 CGCTGGATTGTGCACTACAAGGG - Intronic
1183593584 22:38796176-38796198 CACTGGACTGTGCCTTCCATGGG - Intergenic
1184500741 22:44870105-44870127 CACTGCACCTGGCCCTACAATGG + Intergenic
949156226 3:830248-830270 CACTAGGCAGTGCCCTACAAGGG + Intergenic
950118812 3:10468278-10468300 CCCTGTACTGTGCCCCACTAAGG - Intronic
952750939 3:36824391-36824413 CACTGTGCTGTGCCATCCACTGG + Intergenic
953538826 3:43796434-43796456 CACAGTACTGTGCCCCAGTACGG + Intergenic
956515342 3:70040473-70040495 CACTGTGCTGTTTTCTACAAAGG - Intergenic
959563038 3:107804400-107804422 CACTGCTCTGTAACCTACAATGG - Intronic
960504351 3:118474488-118474510 CACTTTGCTGTGCCCCACAGGGG - Intergenic
962284281 3:134073640-134073662 CCCTGTCCTGTGCCCTGGAAAGG - Intronic
963732883 3:148989837-148989859 CACTTTTCTGTTTCCTACAACGG + Intergenic
964168962 3:153744180-153744202 CACTGTACTAAGCACTACAGGGG + Intergenic
967686143 3:192418962-192418984 CACAGTCCTGGGCCCTACACAGG + Intronic
969359566 4:6654002-6654024 CACTGAACTGTACCCTTAAATGG + Intergenic
971154386 4:24065863-24065885 CCCTGTGCTGTGCCCTTTAAAGG + Intergenic
979380448 4:119999723-119999745 TATTATACTGTGCCCCACAAAGG - Intergenic
980478833 4:133358021-133358043 CACTGTTCCATGCCCTACCAAGG + Intergenic
981350456 4:143723440-143723462 CACCGTGCCCTGCCCTACAATGG - Intergenic
984943143 4:184951728-184951750 CACTGAACTGTACCTTTCAAAGG + Intergenic
985986745 5:3522447-3522469 CTCGTTACTGTGCCCTTCAATGG + Intergenic
989711192 5:44399428-44399450 CACAGTGCTGCTCCCTACAAGGG + Intergenic
992174397 5:74135158-74135180 AACAGTGCTGTGTCCTACAAGGG - Intergenic
995641152 5:114259094-114259116 CACTGTACTCAGCTCTGCAAGGG - Intergenic
996878216 5:128263336-128263358 CACTGTACTCTTCCCTGCAGTGG + Intronic
997534408 5:134606955-134606977 CAATGTACTGTGCCATCCAGCGG + Exonic
998001501 5:138629543-138629565 CACTGAACTGTGGCCCACAGTGG - Intronic
1003317320 6:5024421-5024443 CACTGTACTGTTTCCTTCAAAGG - Intergenic
1009599378 6:65778721-65778743 AATTGTAATGTGACCTACAAGGG - Intergenic
1010978004 6:82338544-82338566 AACTATACTGGGCCCTAAAAAGG + Intergenic
1013066837 6:106692436-106692458 CACTGTAATGTGACCTCCCACGG + Intergenic
1013708811 6:112873174-112873196 CACTGTACTGTCTTCCACAATGG - Intergenic
1015161116 6:130152968-130152990 CATTGGAGTGTGGCCTACAAAGG - Intronic
1015719306 6:136224914-136224936 CACTGTACTGTCTTCCACAATGG - Intergenic
1016563141 6:145419221-145419243 CACTGTACTGTACTGTTCAATGG - Intergenic
1018731159 6:166651903-166651925 CACTGCACTGTGCCCCCCAACGG + Intronic
1021540256 7:21749504-21749526 CACAGTGCTGTCCCCTAGAATGG + Intronic
1021580516 7:22148066-22148088 CACCACACTGTGCCCTACACTGG - Intronic
1023063725 7:36354038-36354060 CACTGTACTCTTTCCTGCAAAGG + Intronic
1024062612 7:45710190-45710212 CTCTGTGCTGAGCCCTACCAGGG - Intronic
1024191245 7:47012763-47012785 CATTGTCCTGTTCCCCACAAAGG - Intergenic
1024306807 7:47936202-47936224 CACTGAACTGTGCCTTCAAATGG - Intronic
1026499752 7:70934350-70934372 CACTTTACTAAGCCCTGCAAAGG - Intergenic
1028381538 7:90205620-90205642 CACTGAACTGTACTCTTCAAAGG - Intronic
1028968886 7:96834310-96834332 CAGTGTATTGATCCCTACAATGG - Intergenic
1031801710 7:126254825-126254847 CACTGTAATGTGCCTTAGAGAGG - Intergenic
1031985712 7:128163550-128163572 CCCTGTTCTGAGCCCCACAATGG - Intergenic
1033451150 7:141463352-141463374 CACTGGACTTTGCCATCCAAAGG + Intronic
1034931715 7:155168400-155168422 CACTGGAATATGCCCTTCAAGGG - Intergenic
1036399701 8:8396871-8396893 CAATGTACTGTGCACTTAAATGG + Intergenic
1038631742 8:29251730-29251752 TACTGAACTGTGCACTTCAAAGG + Intronic
1039683436 8:39768341-39768363 GACTTCATTGTGCCCTACAATGG - Intronic
1042871882 8:73406986-73407008 CAGTTTACTGTGCTCTACAAGGG - Intergenic
1043870850 8:85430204-85430226 AACTATACTGGGTCCTACAAAGG + Intronic
1045368422 8:101497108-101497130 CAGAGTTCTGTTCCCTACAATGG + Intronic
1049786397 8:144452948-144452970 CGCTGTCCTGGGCCCTTCAAGGG + Intronic
1053604502 9:39643089-39643111 CACCAAACTGTGCCCTTCAATGG - Intergenic
1053862316 9:42399112-42399134 CACGAAACTGTGCCCTTCAATGG - Intergenic
1054249039 9:62699325-62699347 CACCAAACTGTGCCCTTCAATGG + Intergenic
1054563153 9:66733858-66733880 CACCAAACTGTGCCCTTCAATGG + Intergenic
1056317767 9:85408101-85408123 AACTGTACAGTGCTATACAAAGG + Intergenic
1059529658 9:115024043-115024065 AACTGTGCTCTGTCCTACAAAGG - Exonic
1186202893 X:7171787-7171809 CACTATACTGATCCCTCCAATGG - Intergenic
1190388932 X:49912308-49912330 GACTGTCCTGTGCCCTGCAATGG - Intergenic
1191006980 X:55719837-55719859 CATAGTACTGTGCCCTACGTTGG + Intronic
1194178498 X:90683896-90683918 CAGTGTCCTTTGCCATACAATGG + Intergenic
1197132524 X:123020895-123020917 CACTGGACTTTGCCTTTCAATGG - Intergenic
1200441203 Y:3214401-3214423 CACTGTTCAGTTCCCTACAGTGG - Intergenic
1200525161 Y:4266061-4266083 CAGTGTCCTTTGCCATACAATGG + Intergenic
1200725104 Y:6660352-6660374 CACTACACTGTCTCCTACAATGG - Intergenic
1202365058 Y:24154637-24154659 CACTGAACTGTACACTTCAAAGG - Intergenic
1202505723 Y:25515485-25515507 CACTGAACTGTACACTTCAAAGG + Intergenic