ID: 916532714

View in Genome Browser
Species Human (GRCh38)
Location 1:165673504-165673526
Sequence CAGAAAGATGTTACTGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 1, 1: 7, 2: 49, 3: 103, 4: 355}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916532714_916532719 -7 Left 916532714 1:165673504-165673526 CCCTTTGCAGTAACATCTTTCTG 0: 1
1: 7
2: 49
3: 103
4: 355
Right 916532719 1:165673520-165673542 CTTTCTGGCAAACCATGGAAGGG 0: 3
1: 5
2: 5
3: 24
4: 181
916532714_916532718 -8 Left 916532714 1:165673504-165673526 CCCTTTGCAGTAACATCTTTCTG 0: 1
1: 7
2: 49
3: 103
4: 355
Right 916532718 1:165673519-165673541 TCTTTCTGGCAAACCATGGAAGG 0: 3
1: 2
2: 10
3: 36
4: 198
916532714_916532721 5 Left 916532714 1:165673504-165673526 CCCTTTGCAGTAACATCTTTCTG 0: 1
1: 7
2: 49
3: 103
4: 355
Right 916532721 1:165673532-165673554 CCATGGAAGGGACAATACTGAGG 0: 3
1: 4
2: 14
3: 40
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916532714 Original CRISPR CAGAAAGATGTTACTGCAAA GGG (reversed) Intronic
901197121 1:7446571-7446593 CAGAAAGGTGATACGGCAAACGG + Intronic
902064738 1:13675228-13675250 CAGAAAGAAATGACTGCAAATGG - Intergenic
902947324 1:19851035-19851057 CAGATACATGTTACAGGAAAGGG + Intergenic
904573196 1:31483500-31483522 CAGAAAGACATTTCAGCAAAGGG - Intergenic
905959257 1:42029990-42030012 CAGAAAGCAATTGCTGCAAAAGG + Intronic
906444450 1:45882742-45882764 CGGATAGATGTAAATGCAAAGGG - Intronic
907510226 1:54952553-54952575 CAGAAAGATGTTGCAGGAAAGGG - Intergenic
908328152 1:63044055-63044077 CAGAAAGATGTTACAGAAAAGGG - Intergenic
909280330 1:73743192-73743214 CAGAATGTTGCTACTGAAAAAGG - Intergenic
910023597 1:82622959-82622981 CAGAAAGATGTTACAGGAAAGGG - Intergenic
910280580 1:85496269-85496291 CATACAGATGAAACTGCAAATGG + Intronic
910634721 1:89394745-89394767 CATGAAGATGTGACTGCAAATGG - Intergenic
911576888 1:99588624-99588646 CAGAAAGATGTTACCGTAAAGGG + Intergenic
911695483 1:100886300-100886322 TAGAATGATGTTGCTGCAATAGG + Intronic
913705796 1:121421691-121421713 TAGGAAAATGTTACTGCAAAAGG + Intergenic
915701917 1:157804317-157804339 CTGAAAGATAATACTGCACAGGG - Intronic
916496278 1:165350951-165350973 CACAAAGCTATTTCTGCAAAGGG - Intronic
916532714 1:165673504-165673526 CAGAAAGATGTTACTGCAAAGGG - Intronic
916687683 1:167162019-167162041 CAGATATCTGTTACTGGAAAGGG - Intergenic
916810737 1:168303483-168303505 CAAAAAGATGTTACTGAGAAGGG + Intronic
916889544 1:169103041-169103063 CAGAAGGATCTTACTGCTAGGGG + Intergenic
916954825 1:169820800-169820822 CAGGAAGTTATTACTGGAAAGGG + Intronic
917215820 1:172677018-172677040 CAGAAATAAGTTACAGGAAAGGG - Intergenic
917293382 1:173494078-173494100 CAGAAATACGTTACAGGAAAGGG - Intergenic
917650995 1:177077283-177077305 CTGAAAAATGTGACTGCAATTGG - Intronic
917708114 1:177655222-177655244 CAGAAATATGTTACAGGAAAGGG - Intergenic
919605834 1:199682513-199682535 CTGACAGATCTTACAGCAAATGG + Intergenic
920135015 1:203762684-203762706 CAGAAAGGTGTTACAGGGAAGGG - Intergenic
920247277 1:204597760-204597782 CAGATAGATCTTGCTGCAATGGG + Intergenic
921467500 1:215506890-215506912 CAGAAAGATATTATTAAAAATGG + Intergenic
921474130 1:215585050-215585072 CAGGAAGATGTTACTGGAAAGGG + Intronic
921584433 1:216930841-216930863 CAAAAAGAAGGAACTGCAAATGG + Intronic
921645605 1:217612337-217612359 CAGAAATATCTTTCTGTAAAGGG - Intronic
922061726 1:222099072-222099094 GAGAAAGAGGTTTCTGCAGAAGG + Intergenic
923252921 1:232193781-232193803 CCTAAAGATGATCCTGCAAAAGG - Intergenic
923294668 1:232581965-232581987 CTGAAAAATGTTCCAGCAAAAGG - Intergenic
923599278 1:235387759-235387781 GGGAAAGATGTTACAGGAAATGG + Intronic
923601964 1:235411476-235411498 CAGAAAGATGTTACCAGAAAGGG + Intronic
924501697 1:244644283-244644305 CAGGAAGAGGTTACTGAATATGG + Intergenic
924777830 1:247122832-247122854 CAGAGAGATGTTTCTGCTGATGG + Intronic
924885625 1:248213049-248213071 AAGAAAGAAGGAACTGCAAAGGG - Intergenic
1063216265 10:3928768-3928790 CTGAAGGATGTTACTCTAAATGG + Intergenic
1063301637 10:4854498-4854520 AAGAAAGATGTTACAGCAAAGGG - Intergenic
1063619456 10:7632300-7632322 CAACAGGATGTGACTGCAAATGG + Intronic
1064747711 10:18494165-18494187 CAGAAAGAGGGGACTGAAAAAGG - Intronic
1064907194 10:20359360-20359382 CAGAAATATCTTTCTGGAAAAGG - Intergenic
1064953512 10:20880870-20880892 CAGAAACATGATGCTGCCAAAGG - Exonic
1064978583 10:21144121-21144143 CAGAAAGGTGGCACTGCCAAGGG + Intronic
1065310965 10:24415732-24415754 CAGAGAGATGGCACTGAAAAGGG - Intronic
1066502440 10:36007144-36007166 CAGAAAGATGTTATTTTATAGGG - Intergenic
1066977118 10:42379147-42379169 CAGAAAAATGTTACCAGAAACGG + Intergenic
1067537332 10:47123049-47123071 CAGAAAATTGTTACTGAAAGTGG + Intergenic
1068316793 10:55354892-55354914 GAGAAAGGTGTAACTACAAAGGG - Intronic
1068468094 10:57421631-57421653 CAGAAAGCTTTTTCTGTAAAGGG + Intergenic
1068705724 10:60073304-60073326 TATAAAGATGTTTCTGAAAATGG - Exonic
1068947270 10:62742036-62742058 CAGAAAGCTTTTACTGTAAAGGG + Intergenic
1069936351 10:71919967-71919989 CTGAAAGATGTTACCAGAAAGGG + Intergenic
1070026583 10:72637781-72637803 CAAAAAGATCTTTCTGGAAAGGG + Intergenic
1070251344 10:74776244-74776266 CAGAAATATGTTACAGGAAAGGG - Intergenic
1071320311 10:84448723-84448745 GAGAAAGAACTGACTGCAAAGGG - Intronic
1071543351 10:86508170-86508192 CAGATAGATGTTACTTAAAGTGG - Intronic
1072425837 10:95329810-95329832 CAGAAAGATGTGACTTCAGAGGG - Intronic
1072443527 10:95478203-95478225 GAGAATGATCTTACTGGAAAGGG + Intronic
1072565790 10:96615667-96615689 CAGGAAGGTGTTACTGAGAAGGG + Intronic
1072911879 10:99509424-99509446 CAGAGAGATGTGACTACATAAGG + Intergenic
1073439677 10:103545060-103545082 CTGAGAGAAGTTACTGGAAAGGG + Intronic
1074690076 10:115996571-115996593 CAGAAAGATGTTACTGGAAAGGG + Intergenic
1074893645 10:117756084-117756106 CAGAAAGATGCTCTTGCAAAGGG - Intergenic
1076012514 10:127001849-127001871 CAGAAAGATGAAAATGCAAAAGG - Intronic
1077005195 11:351723-351745 CAGAAAGATGTTACCGGAAAGGG + Intergenic
1077873610 11:6284155-6284177 CAGAAAGATGTTACAGGAAAGGG - Intergenic
1079227135 11:18616636-18616658 CAAAAAGCTGTTACTTCAAGGGG + Intronic
1079235137 11:18682972-18682994 CAGGAAGATGTTACCAGAAAGGG - Intergenic
1079412317 11:20201037-20201059 CAGAAATATGTTACAGGACAGGG - Intergenic
1079579289 11:22042327-22042349 AAGAAAGATGTTTATGCCAAAGG - Intergenic
1080239384 11:30109161-30109183 CAGAAAGATATTGTAGCAAAAGG - Intergenic
1080288158 11:30640484-30640506 CAAAAAGATGTTACCGGAAAGGG - Intergenic
1080422454 11:32123221-32123243 CAGAAAGAGGTTACTAAATAAGG + Intergenic
1082820446 11:57541258-57541280 GAGAAAGATGGTACTGCCAAGGG + Intergenic
1083720110 11:64599723-64599745 CAGGAAGATGTTGCTGCCCAGGG - Exonic
1083835556 11:65264536-65264558 CAGAAGGATGTTACAGGAGAAGG - Intronic
1084571040 11:69960009-69960031 AAGGAAGTTGTTGCTGCAAATGG - Intergenic
1084878887 11:72155384-72155406 CAGGAAGATGTTACCAGAAAGGG + Intergenic
1084902278 11:72318518-72318540 CAGAAAGATGTTAGTGTTACAGG - Intronic
1086078980 11:82882916-82882938 AAGAACGATGATACTTCAAAAGG + Intronic
1086232641 11:84588966-84588988 CAGAAAGATGTTACCAGAAAGGG - Intronic
1087956495 11:104294680-104294702 GAGTAAGATGTTTCTGCAGATGG - Intergenic
1089488569 11:118866453-118866475 CAGGAAGACGTTACTGGAAAGGG - Intergenic
1090455327 11:126844114-126844136 CAGGAAGATGTTACTGGAAAGGG - Intronic
1091541482 12:1466405-1466427 CAGAATGATGTGACTGCATTTGG - Intronic
1092136024 12:6147835-6147857 CAGAAATATGTTACAGGAAAGGG - Intergenic
1092268437 12:7001783-7001805 CAGAAAAATGTTAGTGAAAAAGG - Intronic
1092652959 12:10654445-10654467 CAGGAAGATGTTATTGGAAAGGG - Intronic
1093091426 12:14925222-14925244 CAGAAAGATGTTAGTGAAAAGGG - Intronic
1093751111 12:22801180-22801202 CAGCAAGCTATTTCTGCAAAGGG - Intergenic
1094100084 12:26752775-26752797 CAGAATGATGTTACAGGAAAGGG - Intronic
1094284617 12:28779239-28779261 AAGAAAGATGCTGATGCAAATGG + Intergenic
1094594045 12:31847839-31847861 CAGAAAGATGTTACTGGAAAGGG - Intergenic
1094594441 12:31851931-31851953 CATAAAGAAGTTACAGAAAATGG + Intergenic
1095059671 12:37667670-37667692 CACAAAGATGTTTCTGAGAATGG + Intergenic
1095064305 12:37748576-37748598 CACAAAGAAGTTACTCAAAAAGG - Intergenic
1095799580 12:46257825-46257847 CAGAAAGATGTTACAGGAAAAGG + Intronic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1097039483 12:56146812-56146834 GAGAAAGATATGACTGCATATGG + Intergenic
1098439106 12:70499471-70499493 CAGAAAGATGTTACCACAAAAGG + Intergenic
1099799819 12:87442887-87442909 CAAAAATATGTTACAGGAAAGGG + Intergenic
1101396607 12:104354276-104354298 AAGAAAGATGCTACAGCAGAAGG + Intergenic
1102074743 12:110050883-110050905 CAGAAATACGTTACAGGAAAAGG - Intronic
1102529816 12:113537989-113538011 CAGATATATGTTCCTCCAAATGG - Intergenic
1103245847 12:119456497-119456519 TAGAAAGATGTTACATGAAAGGG + Intronic
1104127711 12:125863179-125863201 CAGGAAGATATTACAGGAAAGGG + Intergenic
1104460215 12:128949546-128949568 AAGAAACGTGTTTCTGCAAATGG - Intronic
1104507262 12:129344234-129344256 CAGAAATATGTTACAGGAAAGGG - Intronic
1104656606 12:130578302-130578324 GAGAAAGATGATTCTGGAAACGG - Intronic
1105778219 13:23682308-23682330 CAGAAAGATGTTACAAGGAAAGG - Intergenic
1106591060 13:31098924-31098946 CAGAAAGATGTTACCGGAAAGGG - Intergenic
1106673049 13:31927935-31927957 CAGAAAGATGTTTCACCACAAGG - Intergenic
1106866886 13:33974379-33974401 CACAAAGATGTGACTGCTAATGG - Intergenic
1106989820 13:35404999-35405021 AAGAGAGATGATACTGGAAAGGG + Intronic
1107311237 13:39081263-39081285 CAGGAAGATGTTACCAGAAAGGG - Intergenic
1107970983 13:45641921-45641943 CAGAAAGATGTTACAGGAAAGGG - Intergenic
1107991492 13:45822683-45822705 CAGAAAAATGTTACTTGTAAAGG + Intronic
1108371421 13:49773213-49773235 CAGGAAGGGGTTACTGCAAAGGG + Intronic
1109345661 13:61112801-61112823 CAGAAAGATGTTACTGGAAAAGG - Intergenic
1110211605 13:72980197-72980219 CATAAAGATGTTACTTTACATGG + Intronic
1114270107 14:21095573-21095595 CAGAGAGATGTTAAAACAAATGG + Intronic
1114790242 14:25649880-25649902 CAGAAAGATGTTACCAGAAAGGG + Intergenic
1115129877 14:30042465-30042487 CAGAAAGATGTTACAAGAAAGGG - Intronic
1115481816 14:33868255-33868277 CAGAAATATGTTACAGGACAGGG - Intergenic
1116105206 14:40493959-40493981 CATAGAGATGTTACTGGCAAAGG - Intergenic
1116421279 14:44735541-44735563 AAGAAAGCTGTTATTCCAAAAGG - Intergenic
1116438624 14:44923762-44923784 CAGAAAGCTGGGACTGCAATGGG + Intergenic
1118402490 14:65392705-65392727 GAGAAAAATGTTACTTAAAATGG + Intergenic
1118406861 14:65433035-65433057 GAGAAACATGTTACAGGAAAGGG - Intronic
1119101497 14:71884125-71884147 AGGAAAGCTGTTACTGGAAAGGG - Intergenic
1119538950 14:75426694-75426716 CAGAAAGATTTCACTGCACTGGG + Intergenic
1119562303 14:75600536-75600558 TATAACGATGTTACTGGAAAGGG - Intronic
1120394733 14:83954971-83954993 CAGAAATATGTTACAGGACAGGG - Intergenic
1120565945 14:86057151-86057173 CAAAAATAAATTACTGCAAAGGG + Intergenic
1120912953 14:89684139-89684161 CAGAAAGATGTTACCGGAAAGGG - Intergenic
1121610574 14:95276072-95276094 CAGGAAGGTGTTACTGGAAAGGG - Intronic
1122592197 14:102861622-102861644 CAGGAAGATGTTACCGGAAAGGG + Intronic
1123147579 14:106148204-106148226 CAGAAAGATGGGAGAGCAAAAGG - Intergenic
1124388087 15:29226392-29226414 CAGAATGATGTTCCTACAAACGG + Intronic
1124431821 15:29614754-29614776 CAGGAAGAAGTTACTGCAAGGGG + Intergenic
1125186797 15:36940172-36940194 CAGATAGATTTTCCTGGAAATGG - Intronic
1126260390 15:46682560-46682582 GAGAAATATGTTACAGGAAAGGG - Intergenic
1126623831 15:50667035-50667057 CAGAAAGATGTTACCAGAAAGGG - Intronic
1126726483 15:51637174-51637196 CAGGAAGATGTTACCGGAAAGGG + Intergenic
1126826457 15:52554354-52554376 AAGGAAAAGGTTACTGCAAAAGG + Intronic
1127372302 15:58352838-58352860 CAGAAAGATGTTATCAGAAAGGG + Intronic
1127560463 15:60131408-60131430 CAGAAAGAGGTTACAGCAAAGGG - Intergenic
1127691037 15:61398161-61398183 CACAAAGATCTTCCTGGAAAGGG + Intergenic
1127729705 15:61788406-61788428 CAGTAAGATATTAGTGAAAATGG + Intergenic
1130149884 15:81303504-81303526 CAAAAACATTTTACTGCAAGAGG - Intronic
1131298291 15:91171913-91171935 CAGAAGGATGATTCTGCAGATGG - Intronic
1131893197 15:96996822-96996844 CAGAAAGATGAAAAAGCAAATGG + Intergenic
1132742808 16:1423840-1423862 CAGAAATATGTTACAGGAAAGGG + Intergenic
1133392139 16:5419182-5419204 CAGATAGATGTTTATGTAAAGGG + Intergenic
1133547398 16:6820767-6820789 CAGAGACTTATTACTGCAAAAGG + Intronic
1134394996 16:13854420-13854442 CTGAAAAATGTTGCTGCAGAGGG + Intergenic
1134856253 16:17522054-17522076 CAGGAAGATGTTGCTTCAACAGG + Intergenic
1137683563 16:50370834-50370856 CAGAAAAATGTTCCTGGAAGTGG + Intergenic
1137848026 16:51710938-51710960 CATAAACAAGTTGCTGCAAAAGG + Intergenic
1140594237 16:76390211-76390233 CAGCAAGATGTTTCTGAAAATGG + Intronic
1140640127 16:76961850-76961872 CTGAAATTTGTTATTGCAAATGG - Intergenic
1141783264 16:86179361-86179383 CAAAAAGATGTATATGCAAATGG + Intergenic
1142181234 16:88671775-88671797 CAGACAGAACTTACTGCCAATGG - Intergenic
1144427699 17:15159520-15159542 CCAAAAGTTGTTACTTCAAAGGG - Intergenic
1145405124 17:22583402-22583424 CAGAAATATGTTACAGGAATAGG + Intergenic
1148298642 17:46526183-46526205 CAGGAAGATTTGACTCCAAAAGG - Intronic
1148613150 17:48978417-48978439 CAGGAAGATGTTACCGGAAAGGG - Intergenic
1148626915 17:49076363-49076385 CAGGAAGATGTTATCGGAAAGGG + Intergenic
1149211968 17:54314451-54314473 CAGAAAGATATTACCAGAAAGGG + Intergenic
1150349463 17:64431436-64431458 CAGGAAGATGTTCCTGGAAAGGG + Intergenic
1151273154 17:73012489-73012511 CAGCAAACTGTTTCTGCAAAGGG + Intronic
1153048435 18:878115-878137 TAGAAAGCTTTTATTGCAAAAGG - Intergenic
1153511735 18:5862223-5862245 CAGAAAAATGTTACTGGAAAGGG - Intergenic
1154506759 18:15048042-15048064 CAGAAAGAAGTTAATGTTAATGG + Intergenic
1156415470 18:36884121-36884143 TTGAAAGATGTTATTGCAAGTGG + Intronic
1156831453 18:41496865-41496887 CAGAAAGGTGATTATGCAAAGGG - Intergenic
1157649540 18:49313775-49313797 CAAAAAGATGTTACCAGAAAGGG - Intronic
1157654656 18:49373156-49373178 GAGAAATATGTTACAGGAAAGGG + Intronic
1158388570 18:57022792-57022814 CAAAAAGATGTTACCTGAAAAGG - Intronic
1158821104 18:61159616-61159638 GAGAAAGAAGTTACTGGACAGGG + Intergenic
1163342733 19:16720043-16720065 CAGAACGCTGACACTGCAAAGGG + Exonic
1164098903 19:22036791-22036813 CAGAAAGCTGTTACTGAAAAGGG - Intergenic
1164118786 19:22247012-22247034 CAGAAAGCTGTTACTGAAAAGGG - Intergenic
1164274013 19:23701006-23701028 CAGAAACATGTTACAGGAAAGGG - Intergenic
1164346393 19:27266169-27266191 CACAAAGAAGTTTCTGAAAATGG - Intergenic
1164421187 19:28094375-28094397 CAAAAAGCTTTTATTGCAAAGGG - Intergenic
1164470043 19:28522632-28522654 GAGAAATATGTTACAGGAAACGG - Intergenic
1164600435 19:29559752-29559774 CAAATAGATGTTACAGAAAAGGG - Intronic
1164915672 19:32050582-32050604 CGGAAAGATGTTACAGAAAAGGG - Intergenic
1165296008 19:34926305-34926327 CAGAGAGGTGTTACTGGAAAAGG + Intergenic
1166426945 19:42687498-42687520 CTGAATGATGTTACTGAAAGTGG - Intronic
1167830827 19:52020924-52020946 CAGGAGGATGGTACTGCACAGGG - Intronic
1168327532 19:55545849-55545871 CAGAAAGGTGTTCCTGTAGAAGG - Intergenic
1168623272 19:57895774-57895796 CAGAAAGATGTTACCAGAAAGGG + Intronic
925918028 2:8621069-8621091 CAGGAAGATGTTACCGGAAAGGG + Intergenic
926313085 2:11688536-11688558 CCGCAAGATGTTTCTGCGAAGGG - Intronic
927406500 2:22776012-22776034 CTGAAAGATGTAAGTGGAAAGGG - Intergenic
929283887 2:40114317-40114339 GAGACACATGTTAATGCAAATGG + Intronic
929400556 2:41576041-41576063 AAGAAAGATGTTAATGCTCAAGG + Intergenic
929777882 2:44939715-44939737 CAGAAAAATATTCCTCCAAAGGG - Intergenic
930114588 2:47707822-47707844 CAGGAAGCTGTTCCTGCTAAGGG + Intronic
930151200 2:48061578-48061600 CAGAAAGATGTTAGAGCAAAGGG + Intergenic
930228449 2:48818928-48818950 CAGAAAGAGGTTCAAGCAAAAGG + Intergenic
932387041 2:71344779-71344801 CAGAATTATGTAATTGCAAAAGG + Intronic
932827489 2:74955227-74955249 CAGAAAAATGTTACAGGAAAGGG - Intergenic
932860840 2:75289642-75289664 GAGAAATATGTTACAGGAAAGGG - Intergenic
933427377 2:82130001-82130023 CAGATAGATGTTACAGGAAACGG - Intergenic
933687186 2:85151848-85151870 CAGCAAATTTTTACTGCAAAGGG - Intronic
934029247 2:88026902-88026924 CAGAATGATGTTATAGGAAAAGG - Intergenic
934427789 2:93656963-93656985 CACAAAGAAGTTACTGGGAATGG - Intergenic
935370074 2:102336133-102336155 CAGAAAGGAGTAGCTGCAAAAGG - Intronic
935575208 2:104702015-104702037 CAGAGAGCTCTTTCTGCAAAAGG - Intergenic
935936263 2:108186779-108186801 CAGAAAGATTATCCTGCCAAAGG + Intergenic
936487649 2:112940133-112940155 CATAGTGATGTTACTGGAAAAGG + Intergenic
938781706 2:134590486-134590508 CAGAAAGATGTTACCAGAAAGGG + Intronic
939251949 2:139693023-139693045 GAGAATGATGTGACTGCCAAGGG - Intergenic
939843944 2:147220978-147221000 CAGAAAGATGTTACCAGAAAGGG + Intergenic
940806479 2:158193088-158193110 CAGAAAGATGTATATTCAAAAGG - Intronic
941104074 2:161332674-161332696 AAAAAACATGGTACTGCAAAAGG - Intronic
941236754 2:162984609-162984631 GAGACAGAGGTTCCTGCAAAGGG + Intergenic
941395106 2:164964356-164964378 CATGAAGATGTTACAGAAAAGGG - Intergenic
941695992 2:168551257-168551279 AAGACAGGTGTTACTTCAAAAGG - Intronic
941734372 2:168956764-168956786 CACGGAGATGTTACTCCAAAAGG - Intronic
942487500 2:176455078-176455100 CCGAGAGAGTTTACTGCAAAAGG + Intergenic
942964346 2:181873036-181873058 CAGAAAGAGCTTTCTGGAAAAGG + Intergenic
943466480 2:188235413-188235435 CAGAAAGATGTTACAGGAAAGGG - Intergenic
945729554 2:213516927-213516949 CAGAAATGTTTTAATGCAAACGG - Intronic
945822479 2:214681516-214681538 GAGAAAGATCTCTCTGCAAAAGG + Intergenic
946256960 2:218449502-218449524 CAGAAAGATGATACCCCAAAAGG + Exonic
946424704 2:219587540-219587562 CAGAAAGATGTCACAGGAAAGGG + Intergenic
947817553 2:233048356-233048378 GAGAAAGAAGCTGCTGCAAAAGG + Intergenic
1169313119 20:4564668-4564690 GAGAAACATGTTACTGAAAATGG + Intergenic
1169389894 20:5181373-5181395 CAGAAAGATGTTACCAGAAAGGG + Intronic
1169887873 20:10421569-10421591 CAGAAATCTTTTACTGCAATTGG - Intronic
1170674338 20:18465623-18465645 AAGAAAGAAGTTACTTTAAAAGG + Intronic
1171028139 20:21651737-21651759 CAGAAAGATGTTATAGGAAAGGG - Intergenic
1171028810 20:21657393-21657415 CAGAAGGATGTTATAGGAAAGGG - Intergenic
1171317858 20:24211339-24211361 CAGCAAGAAGGCACTGCAAAGGG - Intergenic
1172300995 20:33850212-33850234 CAGCAAGCTTTTTCTGCAAAGGG - Intronic
1173194064 20:40899514-40899536 CAGAAGGATTTTACTGTAACTGG - Intergenic
1173532776 20:43783103-43783125 TAGGAAGAGGTTACTGGAAAGGG + Intergenic
1173731381 20:45331111-45331133 CAGAAAGATGTTACCAGAAAGGG - Intronic
1175150911 20:56933358-56933380 CAGAAAACTTTTTCTGCAAAGGG + Intergenic
1175858993 20:62139598-62139620 CAGAACAATGTTACTGAAATTGG + Intronic
1176273278 20:64247554-64247576 CAGAAACGTCTTACTGCAACAGG - Intergenic
1176791111 21:13321054-13321076 CAGAAAGAAGTTAACGCTAATGG - Intergenic
1177252547 21:18613146-18613168 CAGTATAAAGTTACTGCAAAAGG - Intergenic
1177684232 21:24416629-24416651 CAGAAAGATGTTACAGGAAAGGG - Intergenic
1177990687 21:28032311-28032333 CAGAAAGAAGTTAATGTTAATGG + Intergenic
1178459585 21:32790580-32790602 CATAAAGATGTTACCAGAAAGGG + Intergenic
1178460634 21:32799118-32799140 TAGAAGGATGGTTCTGCAAAGGG + Intronic
1178968650 21:37149740-37149762 CAGGAAGATGTTCCAGAAAAGGG - Intronic
1179240741 21:39589021-39589043 CAGAAAAATGAAACTACAAATGG + Intronic
1179599672 21:42468228-42468250 CAGCAAGATGATAAAGCAAATGG + Intergenic
1180505856 22:16001814-16001836 CACAAAGATGTTTCTGAGAATGG + Intergenic
1180527032 22:16277796-16277818 CACAAAGATGTTTCTGAGAATGG - Intergenic
1183113304 22:35669227-35669249 CAGAAAGATGTTACAGGAAAGGG - Intergenic
1203332801 22_KI270739v1_random:20233-20255 CACAAAGATGTTTCTGAGAATGG - Intergenic
949105004 3:192965-192987 CAGAAACATGTTAGAGAAAAAGG - Intergenic
950869994 3:16220098-16220120 CAGAAAGAAGATACCTCAAAGGG - Intronic
950913104 3:16615569-16615591 CAGTAAGTTGGTACTGCAGAGGG + Intronic
951897500 3:27624214-27624236 CAGAAGGATGTTCCTTCAGAAGG - Intergenic
952010301 3:28893009-28893031 TAAAAAGTTGTTTCTGCAAATGG - Intergenic
952123687 3:30275138-30275160 CAGAAATATGTTTCAGGAAAGGG - Intergenic
952294490 3:32049301-32049323 CAGCAAGATGTTACTAAAAAGGG - Intronic
952576926 3:34785975-34785997 AAGCAAGATATTACTGAAAAAGG - Intergenic
953153164 3:40343787-40343809 CAGGAAGAAGTTACTGGAAAGGG - Intergenic
953225078 3:41010996-41011018 CAAATTGATGTTTCTGCAAAGGG + Intergenic
953416072 3:42718577-42718599 CAGAAAGATGTTACAGGAAAGGG - Intronic
953609764 3:44437864-44437886 CAGAAATATGTTACAGGAAAGGG + Intergenic
954079181 3:48203027-48203049 CAGAAAGATGCTACAGGAAAGGG - Intergenic
954867708 3:53743960-53743982 TGCAAAGATGTTAATGCAAATGG - Intronic
955007426 3:54982527-54982549 CAGAAAGATGTTACTGGAAACGG + Intronic
955381101 3:58439067-58439089 CAGAAAGATGTTATAGGAAAGGG + Intergenic
955453508 3:59096222-59096244 CAGAAATATGTTACAGGAAAGGG - Intergenic
955659665 3:61284091-61284113 CAGATAGCTGTTAGTTCAAATGG + Intergenic
955956626 3:64296544-64296566 CAGAAAAATGTTACTTGAAGTGG + Intronic
956049135 3:65228792-65228814 CAGAAGGACATTACAGCAAAGGG + Intergenic
957510656 3:81183725-81183747 AAGTAACATGTTACTGGAAATGG - Intergenic
957539206 3:81546919-81546941 CGGAAAGATGTTACCGGAAAGGG - Intronic
958404416 3:93734829-93734851 CACAAAGATGTTTCTGAGAATGG + Intergenic
958457846 3:94355507-94355529 AAAAAAAATTTTACTGCAAAAGG - Intergenic
959673179 3:109002538-109002560 GAGAAAGATATTTCTGCACAAGG + Intronic
960152296 3:114262515-114262537 CAAAAAGATATTACTGGAAAGGG + Intergenic
960293648 3:115916309-115916331 CAGACAGATGTTTATGCAATGGG + Intronic
960304338 3:116042828-116042850 AAGAATGATGTTACTGAACAAGG + Intronic
960386362 3:117026324-117026346 CAGAAATATGTTACAGGAAAGGG - Intronic
960452796 3:117831132-117831154 CAGAAAGAAGCTAAGGCAAATGG + Intergenic
960514638 3:118590178-118590200 CAGAAAGATGTTACAAGAAAGGG - Intergenic
960840523 3:121954332-121954354 CAGAAAGATGTTACCCAGAAAGG + Intergenic
961510938 3:127403056-127403078 AAGAAAGATATTACCGGAAAGGG + Intergenic
961690722 3:128667553-128667575 CAGAAATATGTTACAGGACAGGG - Intronic
961974551 3:131009725-131009747 CAGAAAGCTGTTGCTGAAAGTGG + Intronic
962380963 3:134897823-134897845 CAGAAAGATGTTTCTCCCCATGG - Intronic
962797431 3:138861511-138861533 CAGAAAGAAGGAAGTGCAAAGGG + Intergenic
964060422 3:152515306-152515328 AAGAAAGGTGGTTCTGCAAAGGG + Intergenic
964293558 3:155208878-155208900 GAGCAAGATGCTATTGCAAAAGG - Intergenic
964585357 3:158292647-158292669 CAGAAGGATCTTACAACAAATGG - Intronic
964655547 3:159062657-159062679 AAGCATGATGTTACTGTAAATGG - Intronic
965050749 3:163643921-163643943 CAGAAATATCATACTACAAAAGG + Intergenic
965588779 3:170342978-170343000 CAGAAATATGTTACAGGACAGGG + Intergenic
966147081 3:176824048-176824070 CAGAAATATGTTACAGGAAAGGG + Intergenic
968155810 3:196379856-196379878 CAGAATGATGTTACTGGAAAGGG + Intronic
969420427 4:7091127-7091149 CAGAAAGATGTTACAGGAAAGGG + Intergenic
969634493 4:8358991-8359013 CAGAAAGATGTTACAGGAAAGGG - Intergenic
969992767 4:11281085-11281107 CAGAAAGATGTAACAGAGAATGG - Intergenic
973581736 4:52350625-52350647 CAGAAATATGTTACAGAAAAGGG + Intergenic
974052049 4:56950521-56950543 CAGAAATATGTTTCAGGAAAGGG + Intergenic
974072943 4:57141507-57141529 CAGGAAGATGTTATGGGAAAGGG + Intergenic
974614880 4:64267852-64267874 CAGAAAGATGTTACTGGAAAAGG + Intergenic
975413602 4:74083226-74083248 CAGAAAGATGTTACCAGAAAGGG - Intergenic
975432962 4:74316535-74316557 CAGAAGGAATTTAATGCAAACGG + Intergenic
975774046 4:77764586-77764608 CAGAAAGATGTTACTGGAAAGGG - Intronic
976643297 4:87361866-87361888 CAGAAAGATGTTACCAGAAAGGG - Intronic
976699974 4:87959529-87959551 CAGAAAGATGTTACCAGAAAGGG - Intergenic
976767165 4:88609703-88609725 GAGAAATATGTTACAGGAAAGGG + Intronic
977047764 4:92089042-92089064 CAGAAAGATGTTACAGGAAAGGG + Intergenic
977332103 4:95650171-95650193 AAGAAACATGTTATTGAAAATGG + Intergenic
977499712 4:97823658-97823680 CAGAAAGATATTACCAGAAAGGG - Intronic
977589700 4:98813073-98813095 CAAAAAGATGTTACTGAAAAGGG - Intergenic
977674720 4:99734364-99734386 CAGAAATATGTTACAGGAAAGGG + Intergenic
979773454 4:124558718-124558740 CAAAAAGATGTTACAGGAAAGGG - Intergenic
980465260 4:133169137-133169159 AAGAAAGATGGTACTGCAGATGG - Intronic
980987657 4:139711248-139711270 GAGAAATATGTTACAGGAAAAGG + Intronic
981269468 4:142828000-142828022 CAGGAAAATGATATTGCAAAGGG + Intronic
981464884 4:145056572-145056594 CAGAAAGATGTTACAAGGAAAGG - Intronic
981667262 4:147243832-147243854 CAGACAGATGCTAGTGCAAGGGG - Intergenic
981691021 4:147509215-147509237 AAGAAAGCTGATGCTGCAAAAGG - Intronic
981780119 4:148419982-148420004 CAGGAAGATGTGTCTTCAAAGGG - Intronic
982863969 4:160487788-160487810 CAGGAAGATGTTACAAGAAAAGG - Intergenic
982925254 4:161329018-161329040 CAGAAAGATACTACAACAAAAGG + Intergenic
982971020 4:161986706-161986728 CAGAAAGCTGTTAATTCACAAGG - Intronic
983872758 4:172841181-172841203 CAGAAATATGCTACTGGAAATGG + Intronic
984097616 4:175451285-175451307 CAGAAAGATATTACAGGAAAGGG + Intergenic
984441267 4:179773921-179773943 CCGAAAGATGTTACAGGAAAGGG - Intergenic
984650827 4:182269006-182269028 AAGAAATATGTTACAGGAAAGGG - Intronic
986222803 5:5785005-5785027 CAGAAAAATATTACTGAGAATGG - Intergenic
986758576 5:10859448-10859470 CAGCAAGCTGCTTCTGCAAAGGG + Intergenic
986968611 5:13305359-13305381 CAGAAAGATGTTACAGGATGGGG + Intergenic
987524184 5:19026529-19026551 AAGAAAAAAGTTAATGCAAAGGG + Intergenic
988366965 5:30312296-30312318 CACAAAGATGTTACAACAAAAGG - Intergenic
988608696 5:32704623-32704645 CAGACATATTTTCCTGCAAATGG + Intronic
989408624 5:41091322-41091344 CAAACTGATGTTTCTGCAAAGGG - Intergenic
989542406 5:42632466-42632488 AAGAAAGAGGTTACAGCAAGAGG - Intronic
989638983 5:43565133-43565155 CAGAAAGACGTTACTGGAAAGGG - Intergenic
989743029 5:44794091-44794113 CAGGAAGATGTTACTGGAAAGGG + Intergenic
990210997 5:53481226-53481248 GAGAGAGATGAGACTGCAAATGG - Intronic
991436871 5:66605294-66605316 CAGAAAGGTTTTACTTCAAGAGG + Intronic
991593932 5:68283182-68283204 CACAACAATGTTACTGTAAATGG - Intronic
993043176 5:82838305-82838327 CAGAAAGATGTTATAGGAAAGGG - Intergenic
993099781 5:83523455-83523477 CAGAAAAATGATACTCGAAAGGG - Intronic
993108749 5:83629722-83629744 CATAGAAATGTTACTGGAAAGGG - Intergenic
994076675 5:95659672-95659694 CCGAAAGAGGTAACAGCAAAAGG + Intronic
994108313 5:95971591-95971613 CAGGAAGATCTGACTACAAAGGG - Intergenic
995501779 5:112814934-112814956 AAGAAAGAAATTACTGCATAGGG - Intronic
995800393 5:115987828-115987850 CGGAAAGATGCAATTGCAAATGG + Exonic
996047675 5:118893690-118893712 CAGAAAGAGGAGACTGAAAAAGG + Intronic
996058021 5:119001541-119001563 CAGGAAGATGTTACCAGAAAGGG + Intergenic
996321008 5:122216858-122216880 CATTTTGATGTTACTGCAAATGG - Intergenic
996828823 5:127716912-127716934 CTGAAAGATTTTGCTGCAGAAGG - Intergenic
997154552 5:131539961-131539983 CATAAAGATGTCACAGCAAAGGG + Intronic
998558200 5:143146676-143146698 CAGAAAGATGTGTCTGAGAAAGG + Intronic
999679329 5:154041258-154041280 CAGAAAGATTTTTAAGCAAAAGG + Intronic
999958513 5:156728288-156728310 CAGAAAAAAGTTACTGCATGAGG + Intronic
1000060972 5:157655077-157655099 CAGAAAGAAGTTACAGGAAAGGG - Intronic
1000061364 5:157659274-157659296 CAGAAAGATGTTACAGGAAAGGG - Intronic
1000066247 5:157695270-157695292 CAGAAAGATGTTACAGGAAAGGG - Intergenic
1000105663 5:158056661-158056683 CAGCAAGCTGTTCCTGTAAAGGG - Intergenic
1000415563 5:160980483-160980505 CAGAAAGATATTACAAGAAAGGG - Intergenic
1000430124 5:161141761-161141783 CAGAATGATGTTTATGCAGAAGG + Intergenic
1001934050 5:175692105-175692127 TAGAAAGCTTTTCCTGCAAAGGG + Intergenic
1202774288 5_GL000208v1_random:50885-50907 CAGAAAGAAGTTTCTGAGAATGG + Intergenic
1003545355 6:7053402-7053424 AAAAAAGATGAGACTGCAAAGGG + Intergenic
1004353599 6:14912367-14912389 CACAAACATTTCACTGCAAAAGG - Intergenic
1004400006 6:15279585-15279607 CAGTAAGATTTTAATGCAAGTGG - Intronic
1004432268 6:15555910-15555932 CAGGAAGATGTTACTGGAAATGG - Intronic
1005448934 6:25954369-25954391 CAGAAAGATGTTACCAGAAAGGG + Intergenic
1006560032 6:34903196-34903218 AAGACAGAAGTTACTGGAAATGG - Intronic
1007353449 6:41292364-41292386 CAGAAAGATGTTACAGGAAATGG + Intergenic
1008291557 6:49722036-49722058 TGGAAAGATGTTACAGGAAAGGG + Intergenic
1008559066 6:52705472-52705494 CAGAAAGATGTTAGAGGAAAGGG - Intergenic
1008645057 6:53505266-53505288 GAGAAACATTTTATTGCAAAGGG + Intronic
1008855661 6:56083381-56083403 CAAAAAGATGTGACTGAAGAAGG - Intronic
1009535977 6:64886657-64886679 CAGAAATATGTTGCTGCACATGG + Intronic
1010811092 6:80299442-80299464 CAGAAAGATGTTACTGGAAGGGG + Intronic
1011292819 6:85794062-85794084 CAGGAAGATGTTACTGGAAAAGG + Intergenic
1011647101 6:89470270-89470292 CAGGAAAACGTTACTGAAAATGG + Intronic
1011979524 6:93355667-93355689 CAGAAAAATCTTACTGCTGAAGG - Intronic
1012420379 6:99058121-99058143 CAGAGAGAGGTCACTGCTAAAGG + Intergenic
1013374173 6:109498054-109498076 CAGAACGCTGCTACTGAAAATGG - Intronic
1013473751 6:110488581-110488603 CAGAAAGTTGTTACTGGAAAGGG - Intergenic
1013523414 6:110953383-110953405 CAGGAAGATGTTACTGGAAAGGG - Intergenic
1013527265 6:110986069-110986091 GAGAAAGAAGTTTGTGCAAAAGG + Intronic
1015746820 6:136518748-136518770 CACACAGATGTTAATGGAAATGG + Intronic
1016006346 6:139092767-139092789 CAGAAAGATGTTAGCAGAAAGGG - Intergenic
1016295746 6:142572356-142572378 CAGAAAGATGTTACCGGAACAGG - Intergenic
1016446219 6:144134466-144134488 GAGAAATATGTGACTACAAATGG + Intergenic
1016950012 6:149570009-149570031 CTGAATGATTTCACTGCAAAAGG - Intronic
1017209141 6:151835441-151835463 GAGAAAGAAAATACTGCAAAGGG + Intronic
1017610272 6:156178107-156178129 CGGAAAGATGTTACTGGAAAGGG - Intergenic
1017755768 6:157527752-157527774 CAGGAAGTTGTTTCTGGAAATGG + Intronic
1018234556 6:161711281-161711303 CAGCACGATGGTAATGCAAATGG + Intronic
1018357619 6:163034758-163034780 CAGAAAAATGTTACAGGGAAGGG + Intronic
1019065059 6:169289469-169289491 TGGAAAGATGGAACTGCAAATGG - Intergenic
1019823462 7:3263673-3263695 CAGAAAGATATTACAGGAAAGGG - Intergenic
1020152512 7:5694154-5694176 CAGAAAGGTCTTACTAAAAAGGG + Intronic
1021268167 7:18550820-18550842 AAGAAAGATCTGACTACAAAGGG + Intronic
1021830868 7:24608224-24608246 AAGAAAAATGTTAATGTAAAAGG - Intronic
1022747227 7:33184709-33184731 CAGGAGAATGTTACTGGAAAGGG + Intronic
1022864372 7:34401726-34401748 CACAAAGATATCACTGGAAATGG - Intergenic
1023060144 7:36318823-36318845 CACACAGATATTACTTCAAATGG + Intergenic
1023588847 7:41759447-41759469 CAGAAAGATGTTACAGGAAAAGG + Intergenic
1025517848 7:61676370-61676392 CAAAAAGATGTTACTCAGAAAGG + Intergenic
1025542173 7:62105018-62105040 CAAAAAGATGTTACTCAGAAAGG + Intergenic
1026033104 7:66812477-66812499 CACAAAGGTGTGACTGCAAAGGG + Intergenic
1026170655 7:67951160-67951182 CAGCAAAATGTTCCAGCAAAAGG - Intergenic
1026228009 7:68459632-68459654 GGGAAAGATGTTAATCCAAATGG + Intergenic
1027856179 7:83514419-83514441 GAGAAATATGTTACAGGAAAGGG - Intronic
1028389233 7:90295599-90295621 CAGAAGGATGTTACAGGAAAGGG + Intronic
1029660529 7:101958060-101958082 CAGAAACATGTTCCAGCAAAGGG - Intronic
1029839704 7:103349047-103349069 CATAAAGATGAGACTACAAACGG - Intronic
1030190031 7:106801266-106801288 CAGAAAGATGTTACCGGAAAGGG + Intergenic
1031418281 7:121519079-121519101 GAGAAAGATGGTATTGGAAAAGG + Intergenic
1032162616 7:129522464-129522486 CAGGAAGATGTTACTGAGGAAGG + Intergenic
1032998370 7:137474988-137475010 CATAAACATGTTTCGGCAAATGG - Intronic
1035880872 8:3242951-3242973 CAGAGAGATGTCCCTGCAATGGG + Intronic
1040102230 8:43516042-43516064 CAGAAATTTGGTACTGCAGAGGG + Intergenic
1040533012 8:48281409-48281431 CAGAATACTGTTACTTCAAATGG + Intergenic
1040781985 8:51120451-51120473 CAGAAAAATATTTCTGCACATGG - Intergenic
1043070596 8:75631204-75631226 CAGAAATATGTTACAGGACAGGG + Intergenic
1043251830 8:78084431-78084453 CAAAGAGATGTTGCTGCAAATGG + Intergenic
1044116242 8:88337864-88337886 CAGAAAAATGTTTCTGTAATTGG + Intergenic
1044205476 8:89488097-89488119 CAGAAAGATGTTTTAGCAGAAGG - Intergenic
1044439734 8:92209161-92209183 CAGAAAGATGTTACCGGAAAGGG + Intergenic
1044498216 8:92916808-92916830 CAGAAATATGTGAGTGAAAAAGG - Intronic
1045114540 8:98968720-98968742 CAACAAGATATTACAGCAAAAGG - Intergenic
1045428100 8:102087217-102087239 CAGAAGGATGTTACTGGAAAGGG - Intronic
1045688605 8:104737247-104737269 CAGAAAGATACTACAGGAAAGGG - Intronic
1046024014 8:108700265-108700287 CAGATAGATGCTAATGCAGAGGG + Intronic
1046361332 8:113161286-113161308 CAGAAAGCTGTTACAGAAAATGG + Intronic
1047433895 8:124818284-124818306 GAGAAAAGTTTTACTGCAAAGGG + Intergenic
1048270001 8:133020893-133020915 CACACAGATGTTTCTACAAAGGG - Intronic
1048514738 8:135095907-135095929 GAGAAAGGTGAGACTGCAAATGG + Intergenic
1048688757 8:136934623-136934645 CAGAAATATGTTACAGGAAAGGG - Intergenic
1048950725 8:139494773-139494795 AAGAAAGATGATTCTACAAATGG - Intergenic
1049456554 8:142694346-142694368 CAGAAAGATGTTGCTGGAAGAGG + Intergenic
1050103989 9:2146500-2146522 CAGAAAGATGTTGCTGAAAAGGG + Intronic
1051225219 9:14892135-14892157 CATAAAGATGTTACAGGAAAGGG - Intronic
1051997140 9:23231467-23231489 CTGTAAGAAGTTACTTCAAAAGG - Intergenic
1052036088 9:23682658-23682680 CAGGAAGATGAGAGTGCAAACGG + Intergenic
1052501310 9:29294542-29294564 CATAAAGAAATTAATGCAAATGG + Intergenic
1052520896 9:29547635-29547657 CAGAAATATGTTACAGGAAAGGG - Intergenic
1052663872 9:31469798-31469820 CAGAAATATGTTACAGGAAAGGG + Intergenic
1053012705 9:34643928-34643950 CAGAAAGCTGTTCCTGGAATGGG - Intronic
1053076353 9:35137953-35137975 CAGAAATATGTTACAGGAAAGGG + Intergenic
1053491235 9:38505223-38505245 TTGAAAGATTTTACTGCCAATGG + Intergenic
1053711744 9:40818652-40818674 CACAAAGAAGTTTCTGAAAATGG - Intergenic
1054422209 9:64950530-64950552 CACAAAGAAGTTTCTGAAAATGG - Intergenic
1054796475 9:69306931-69306953 CAGGAAGATGTTACCAGAAAAGG + Intergenic
1055164523 9:73175578-73175600 CAGGAAGATGTTACCAGAAAAGG - Intergenic
1055253963 9:74343958-74343980 CATCAAGATTTTACTGCAGAAGG + Intergenic
1055442653 9:76351959-76351981 CAGAAAGATGCTACTGGAAAGGG + Intronic
1056677333 9:88686604-88686626 CAGGAAGATGTTACTGGAAAGGG - Intergenic
1056728469 9:89142967-89142989 CAGAAAGATGTTACCAGAAATGG + Intronic
1056918388 9:90764005-90764027 CAGAAAGCAGTTACGGAAAATGG - Intergenic
1057163602 9:92908708-92908730 CAGGAAGATGTTACCAGAAAGGG + Intergenic
1057580242 9:96281144-96281166 CAGAAAGATGTTACAGGAAAGGG - Intronic
1057671543 9:97094424-97094446 TTGAAAGATTTTACTGCCAATGG + Intergenic
1058356041 9:104084313-104084335 CAGGAAGATGTTACCAGAAAAGG + Intergenic
1059740549 9:117145504-117145526 CAGAAACATGGTACTGAAACAGG - Intronic
1059838446 9:118184150-118184172 GAGAAATATGTTACAGGAAAGGG - Intergenic
1060681312 9:125567718-125567740 CAGGAAGATGTTACAGGACAGGG - Intronic
1061362105 9:130150176-130150198 CAGATAATTGTTACTGGAAAGGG + Intergenic
1203418052 Un_KI270366v1:1647-1669 CAGAAAGAAGTTTCTGAGAATGG + Intergenic
1187149818 X:16671429-16671451 TAGAAAGATGTTACCAGAAACGG - Intronic
1188126522 X:26375024-26375046 CAGGAAGATGTTACCAGAAAGGG + Intergenic
1188582396 X:31729859-31729881 AAAAAAGATGTTACTGTATAAGG + Intronic
1188838932 X:34991179-34991201 TAGAAAGATGTTACCAGAAAGGG + Intergenic
1189094651 X:38125456-38125478 CAGAAAGATGTTGCTGGAAAAGG - Exonic
1190137905 X:47813880-47813902 CAGGAAGATGTTAGTGGAAAGGG + Intergenic
1190244169 X:48679956-48679978 CAGGAAGATGTTACCGGAAAGGG - Intronic
1190815952 X:53929215-53929237 GAGAAATATGTTACAGGAAAGGG - Intergenic
1190921051 X:54852598-54852620 CAGAAAGAGGTTACAGGAAAGGG + Intergenic
1190947337 X:55108908-55108930 CAGAAATATGTTACAGGACAGGG - Intronic
1190975044 X:55390489-55390511 AAGAAATATGTTACTTCCAAAGG + Intergenic
1191219048 X:57965917-57965939 CAGGAAGATGTTACCAGAAAGGG + Intergenic
1191675940 X:63792584-63792606 AAGCAAGATGTTAGTGCAATAGG + Intergenic
1191844936 X:65540076-65540098 CAGAAAGATGTTACAGGAAAGGG - Intergenic
1192542711 X:71988723-71988745 CAGAAAGATGTTACCAGAAAAGG + Intergenic
1192568720 X:72184698-72184720 TAAAAAAATGTTACTGCCAAAGG - Intronic
1192587586 X:72331371-72331393 AAGGAAGATGTGATTGCAAAAGG - Intronic
1192714580 X:73626019-73626041 CAGGAAGATGTTACTAGAAAGGG + Intronic
1192730783 X:73800821-73800843 CAGAAAGATGTTATAGGAAAAGG + Intergenic
1192864543 X:75117194-75117216 CAGAAAGATGTTACTGGAAAGGG - Intronic
1192888396 X:75362241-75362263 CAAGAAGATGTTACTGAAAAGGG - Intergenic
1193705943 X:84820546-84820568 CAAAAAGATGTCACAGGAAAGGG + Intergenic
1194086336 X:89532871-89532893 CAGAAAGTTGTTACACAAAAGGG + Intergenic
1194296681 X:92134511-92134533 CAGAAAGGTGTAACCGAAAAGGG + Intronic
1195876907 X:109551445-109551467 CAGAAAAATGTTACCAGAAAGGG - Intergenic
1198182229 X:134220975-134220997 CAAAAAGATGTTACCAGAAAGGG + Intergenic
1198844934 X:140900359-140900381 CAGAAAGATATTACAGAAAAGGG + Intergenic
1198941122 X:141956897-141956919 CAGAAAACTTTTTCTGCAAAGGG + Intergenic
1199393647 X:147309461-147309483 CAGAGATATGTTACAGGAAAGGG - Intergenic
1199948261 X:152684357-152684379 CGGAAAGATGTTACTGGAATGGG - Intergenic
1199961418 X:152784097-152784119 CGGAAAGATGTTACTGGAATGGG + Intergenic
1199969038 X:152845105-152845127 CAGAAAAATGTTCCCCCAAATGG + Intronic
1200274263 X:154717202-154717224 CAGAAACATCTGACTGTAAAGGG + Intronic
1200438998 Y:3188749-3188771 CAGAAAGTTGTTACACAAAAGGG + Intergenic
1201267051 Y:12217312-12217334 CAGAAAGTGCTTACTGCACAGGG - Intergenic
1201406515 Y:13655513-13655535 CAGAAAGATACTAATGGAAAGGG - Intergenic