ID: 916533509

View in Genome Browser
Species Human (GRCh38)
Location 1:165680864-165680886
Sequence CTCTTTCTGTTCCCAGTTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2525
Summary {0: 5, 1: 83, 2: 160, 3: 868, 4: 1409}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916533509_916533518 28 Left 916533509 1:165680864-165680886 CCCGAAACTGGGAACAGAAAGAG 0: 5
1: 83
2: 160
3: 868
4: 1409
Right 916533518 1:165680915-165680937 CTAGGGAGGCCTCAGAATCATGG 0: 66
1: 1345
2: 6052
3: 6496
4: 3963
916533509_916533513 5 Left 916533509 1:165680864-165680886 CCCGAAACTGGGAACAGAAAGAG 0: 5
1: 83
2: 160
3: 868
4: 1409
Right 916533513 1:165680892-165680914 ATTGGATTTACAGTTCCACATGG 0: 79
1: 1473
2: 2661
3: 4343
4: 6620
916533509_916533515 11 Left 916533509 1:165680864-165680886 CCCGAAACTGGGAACAGAAAGAG 0: 5
1: 83
2: 160
3: 868
4: 1409
Right 916533515 1:165680898-165680920 TTTACAGTTCCACATGGCTAGGG 0: 7
1: 306
2: 2874
3: 6809
4: 7579
916533509_916533514 10 Left 916533509 1:165680864-165680886 CCCGAAACTGGGAACAGAAAGAG 0: 5
1: 83
2: 160
3: 868
4: 1409
Right 916533514 1:165680897-165680919 ATTTACAGTTCCACATGGCTAGG 0: 101
1: 2363
2: 6344
3: 7328
4: 7535
916533509_916533516 14 Left 916533509 1:165680864-165680886 CCCGAAACTGGGAACAGAAAGAG 0: 5
1: 83
2: 160
3: 868
4: 1409
Right 916533516 1:165680901-165680923 ACAGTTCCACATGGCTAGGGAGG 0: 324
1: 4567
2: 7054
3: 7797
4: 6072

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916533509 Original CRISPR CTCTTTCTGTTCCCAGTTTC GGG (reversed) Intronic
Too many off-targets to display for this crispr