ID: 916548632

View in Genome Browser
Species Human (GRCh38)
Location 1:165828884-165828906
Sequence CTCCAACTTCATTTGGAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916548621_916548632 29 Left 916548621 1:165828832-165828854 CCCCTAACAGCCTTTAAGATGTG 0: 1
1: 0
2: 1
3: 15
4: 123
Right 916548632 1:165828884-165828906 CTCCAACTTCATTTGGAGCACGG 0: 1
1: 0
2: 1
3: 16
4: 145
916548624_916548632 27 Left 916548624 1:165828834-165828856 CCTAACAGCCTTTAAGATGTGGC 0: 1
1: 0
2: 0
3: 8
4: 98
Right 916548632 1:165828884-165828906 CTCCAACTTCATTTGGAGCACGG 0: 1
1: 0
2: 1
3: 16
4: 145
916548625_916548632 19 Left 916548625 1:165828842-165828864 CCTTTAAGATGTGGCTACTTGTT 0: 1
1: 0
2: 2
3: 11
4: 173
Right 916548632 1:165828884-165828906 CTCCAACTTCATTTGGAGCACGG 0: 1
1: 0
2: 1
3: 16
4: 145
916548626_916548632 -7 Left 916548626 1:165828868-165828890 CCCACCGTTTAACACCCTCCAAC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 916548632 1:165828884-165828906 CTCCAACTTCATTTGGAGCACGG 0: 1
1: 0
2: 1
3: 16
4: 145
916548622_916548632 28 Left 916548622 1:165828833-165828855 CCCTAACAGCCTTTAAGATGTGG 0: 1
1: 0
2: 1
3: 15
4: 117
Right 916548632 1:165828884-165828906 CTCCAACTTCATTTGGAGCACGG 0: 1
1: 0
2: 1
3: 16
4: 145
916548627_916548632 -8 Left 916548627 1:165828869-165828891 CCACCGTTTAACACCCTCCAACT 0: 1
1: 0
2: 0
3: 9
4: 94
Right 916548632 1:165828884-165828906 CTCCAACTTCATTTGGAGCACGG 0: 1
1: 0
2: 1
3: 16
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916548632 Original CRISPR CTCCAACTTCATTTGGAGCA CGG Intronic
900580193 1:3404968-3404990 CTCCATCTACATTTGGACCAGGG - Intronic
901615993 1:10540182-10540204 CTTCAAGTTCATTTCCAGCAAGG - Intronic
902934599 1:19755699-19755721 CTCCAAGGGCACTTGGAGCAGGG + Exonic
904019156 1:27449086-27449108 CGCCAGCTTCCTTTGGGGCAAGG - Intronic
907283667 1:53367075-53367097 CCTCAACTCCATGTGGAGCAAGG - Intergenic
909725235 1:78826933-78826955 TTCCAACTTCTTTTGGACCCAGG + Intergenic
912195269 1:107390287-107390309 CTCCAACTTCAGCTGGACCAGGG + Intronic
913082086 1:115398034-115398056 CTTCTATTTCATTTGGAACATGG - Intergenic
916548632 1:165828884-165828906 CTCCAACTTCATTTGGAGCACGG + Intronic
917537017 1:175881727-175881749 TTCCTGTTTCATTTGGAGCAGGG - Intergenic
917601043 1:176574114-176574136 CTCCACATTCATTTGTATCAAGG - Intronic
917796870 1:178538942-178538964 GTCAAACTTCATTTTGAGCCAGG + Intronic
919481116 1:198091194-198091216 CTCCAACTTCAGTGAAAGCAGGG - Intergenic
921066699 1:211628162-211628184 CTCCTTCTGCATTTGCAGCATGG - Intergenic
922172448 1:223167133-223167155 CTCCATCTTCAATGGGAGCTGGG + Intergenic
1067451232 10:46383329-46383351 CTCCCACTTCAAGTGGGGCAGGG + Intronic
1067586010 10:47476427-47476449 CTCCCACTTCAAGTGGGGCAGGG - Intronic
1071687291 10:87773005-87773027 CTCCAGCTTCATCTGGAGGAGGG + Intronic
1072009130 10:91288118-91288140 CACCAACTTCAGTGGGAGGAGGG + Intergenic
1072828142 10:98629212-98629234 CTCCAGCTTCATTTGGAGGGTGG - Intronic
1074430873 10:113393450-113393472 CTCCAAATTCTTTTAGACCATGG - Intergenic
1074877435 10:117625020-117625042 CTCCATCTTCCTTGGGAACACGG - Intergenic
1075992403 10:126849196-126849218 CCCCAGTTCCATTTGGAGCATGG - Intergenic
1077005328 11:352544-352566 CTCCATCTTGATTAGGAGCTGGG - Intergenic
1078734755 11:14009782-14009804 CTGCATCTTCATGTGGAGGAAGG + Intronic
1081715193 11:45245103-45245125 CCCCAACTTCATGTGGAAGAGGG + Intronic
1082965010 11:58958232-58958254 CTCCAAATACATTTGGAGTTGGG + Intronic
1085253206 11:75157083-75157105 CTCCATCTTCATCTTGAGTAGGG - Intronic
1087011236 11:93516009-93516031 CTTCACATTCATTTGGGGCAGGG + Intronic
1088520201 11:110689317-110689339 CACCAACTTTATTTAAAGCAAGG - Intronic
1090339976 11:126009228-126009250 CTCCAGCTTCATTCAGAGCAAGG + Intronic
1092354921 12:7786842-7786864 CTCCATCTTCAATAGGAGCTGGG - Intergenic
1092367629 12:7890170-7890192 CTCCATCTTCAATAGGAGCTGGG - Intronic
1094549994 12:31441640-31441662 CAACAACTTCATTTGGAGCTGGG - Intronic
1097116245 12:56699509-56699531 CTCCATCTTGAATAGGAGCAGGG - Intergenic
1099038447 12:77619796-77619818 CTCCAAAGTCATTTTGAGAATGG - Intergenic
1099505399 12:83470099-83470121 GACCAAGGTCATTTGGAGCAGGG + Intergenic
1101134066 12:101721377-101721399 CTTTAAAGTCATTTGGAGCAAGG + Intronic
1102290501 12:111695397-111695419 CTCCAACCTCATTTGCAACCTGG + Intronic
1103888769 12:124222828-124222850 TACCAATTTCATTTGGAGCTAGG - Intronic
1104118063 12:125769432-125769454 CTCCAACTTAGTTTGATGCAAGG + Intergenic
1105732001 13:23227092-23227114 TGCCATCTTCATTTGGAACAAGG - Intronic
1109910811 13:68907736-68907758 CTACCAGTTCATTTGGATCAGGG + Intergenic
1111680134 13:91431875-91431897 CTCTAACTTCATTACCAGCAAGG + Intronic
1114862574 14:26543245-26543267 CTCAAACTTTTTTTGGAACAAGG + Intronic
1119181357 14:72607378-72607400 CTCCAACTTCACATGGTGAAGGG + Intergenic
1119712340 14:76831279-76831301 CTCCTACTTCATTCGGAACATGG + Exonic
1119865666 14:77971422-77971444 CTACATTTTCATTTGGAGCTCGG - Intergenic
1121929585 14:97960274-97960296 CTCCCCCTGCATTTGGACCATGG - Intronic
1122410520 14:101523442-101523464 CTCCAACCTCATTTGTACAATGG - Intergenic
1125895989 15:43302068-43302090 CTCCATCTGCATTTGGACCTTGG - Intronic
1130863596 15:87912691-87912713 CTCCAACTTCATTTCTAGTCAGG + Intronic
1133881647 16:9788051-9788073 CTTCAATTTCATCTGCAGCATGG + Intronic
1134779034 16:16878741-16878763 CTCCAACATCATCTCGAGTAGGG - Intergenic
1135646180 16:24164062-24164084 CAGCAACTTCCCTTGGAGCATGG + Intronic
1144270595 17:13611764-13611786 CCCCAAGTCAATTTGGAGCAGGG - Intergenic
1144473061 17:15561754-15561776 CTCCATCTTCAATAGGAGCTGGG + Intronic
1144923421 17:18782966-18782988 CTCCATCTTCAATAGGAGCTGGG - Intronic
1145086094 17:19941906-19941928 TTACAACTTCTTTTGCAGCAAGG - Exonic
1147791887 17:43018883-43018905 CTGCTACTTCATTTGGAAGAAGG - Intronic
1148089293 17:45013240-45013262 CTCCAACTTCAGTGGGAGGCTGG - Intergenic
1152146452 17:78571635-78571657 CTCGAACTCCACTTGGGGCAGGG + Exonic
1152253882 17:79226255-79226277 CTCCCACTTCTCTTGGAGAAAGG - Intronic
1152824952 17:82458793-82458815 CTCACACTTCATCTGGAGCGCGG - Exonic
1154969626 18:21394258-21394280 CTCCAAATTGATGTGGAGCTAGG - Intronic
1158816859 18:61110446-61110468 TTCCAATTTCATTTGGGGAAAGG - Intergenic
1159197901 18:65142316-65142338 CTCCAACTTCATTGTTAGAAAGG - Intergenic
1159213840 18:65364518-65364540 CTGCTACATAATTTGGAGCAGGG - Intergenic
1159894660 18:73984820-73984842 CTCCAATGTCATCTGGAACAGGG + Intergenic
1159951133 18:74484784-74484806 CTTCAAATTCATATGGAGCCAGG + Intergenic
1160435272 18:78847353-78847375 CACCAACTCCACGTGGAGCATGG + Intergenic
1160485998 18:79293143-79293165 ATCCAACTTCATTTTTTGCATGG - Intronic
1161564691 19:4994925-4994947 CCCCAATATCATTTGAAGCAAGG + Intronic
1167513282 19:49908308-49908330 CTCCACCTTCCTCTGCAGCAGGG + Exonic
926473466 2:13291453-13291475 ATCCAAATTCTTTTGGGGCAAGG + Intergenic
927625141 2:24708251-24708273 CTCCCACTTCATTTACATCAGGG - Intronic
928888111 2:36173358-36173380 CACCAAGTTTATATGGAGCATGG - Intergenic
930760328 2:55027890-55027912 CTCAAACTGTATTTGGAGAAAGG + Intronic
932498852 2:72162517-72162539 AACTAACTTCATCTGGAGCAGGG - Intergenic
933727011 2:85432855-85432877 GTCCAAAGTCATTTGGAGCCAGG + Intronic
935501023 2:103838946-103838968 CTTCAACTTCATAAGGAGAAGGG - Intergenic
935547738 2:104418638-104418660 CTCCAACTACATTAAGAGTATGG - Intergenic
936773711 2:115946649-115946671 CACCTACTTCATTTTGTGCAGGG - Intergenic
940363812 2:152823665-152823687 CTCCAATTTCCTGTAGAGCAGGG - Intergenic
940389488 2:153115234-153115256 TTCCAAGTTCATTTGGAATATGG - Intergenic
941994122 2:171585452-171585474 CTCCAGCTTCCTTTGCAGCTAGG + Intergenic
942934547 2:181539406-181539428 CTCCAACTTTTTTTGGAAGAAGG + Intronic
944643148 2:201748462-201748484 CTCCGACATCATTGGGAGCTTGG - Intronic
947089544 2:226494892-226494914 CTGCATCTTCATTTCCAGCAGGG + Intergenic
1173638615 20:44583010-44583032 CTTCACCTATATTTGGAGCAAGG - Intronic
1175665903 20:60859844-60859866 CTCCAACCTTTTTTGGAGCCAGG + Intergenic
1177900578 21:26909967-26909989 CTCCAACTTCTATAGCAGCAAGG + Intergenic
1180784117 22:18537385-18537407 CTACAACTTCATCCGAAGCATGG - Intergenic
1181127684 22:20711434-20711456 CTACAACTTCATCCGAAGCATGG - Exonic
1181241018 22:21476737-21476759 CTACAACTTCATCCGAAGCATGG - Intergenic
1184208803 22:43023280-43023302 CTCCAACTCCCCTTGGGGCAGGG - Intergenic
950095379 3:10326409-10326431 CTCCATGTTCATTCGGAGCCAGG - Exonic
950762362 3:15243352-15243374 CTGCATCTTCATTTGGAGCCAGG - Intronic
950783089 3:15409237-15409259 CTCCAACTACATCTGGAGGAGGG - Intronic
952478786 3:33738372-33738394 CTCCAACATACTTTGGACCAGGG - Intergenic
954028333 3:47800674-47800696 CTATAACTTTCTTTGGAGCAGGG + Intergenic
954938020 3:54344754-54344776 CTCCATCTTAATTAGGAGCTGGG + Intronic
955558992 3:60168493-60168515 CTCCAAGATCATTTGGAGAGGGG - Intronic
955792752 3:62605506-62605528 CTCCCACTTAATTGGGAGCAAGG - Intronic
955940797 3:64145820-64145842 CTCCACCTTCATATGGTACAAGG + Intronic
957454311 3:80420936-80420958 CTTCAAATTCATTTTGAACAAGG - Intergenic
959313452 3:104771493-104771515 CTCAAGGTTCAGTTGGAGCATGG + Intergenic
959467661 3:106709261-106709283 CTGCAACTTTATTTGGAACCAGG - Intergenic
961633782 3:128320304-128320326 TCCCAACTTCATTTGGATTATGG - Intronic
962738053 3:138343462-138343484 CTCCAGCTTCATTAGGAGCTAGG - Intergenic
965712474 3:171569391-171569413 CTCCTACTTCATCTGGTGCAGGG + Intergenic
966258884 3:177951367-177951389 CTGCAACTTCCTTGGGAGAAGGG - Intergenic
971482803 4:27129159-27129181 CTGTAAGTTCCTTTGGAGCAGGG + Intergenic
972733004 4:41813694-41813716 CTCCATCCTCATGTGGAGGAAGG + Intergenic
976077078 4:81312048-81312070 CTCTCCCTTCATCTGGAGCAGGG - Intergenic
976950071 4:90817758-90817780 TTCAAACTGGATTTGGAGCATGG + Intronic
978045843 4:104126154-104126176 CTACAGTTTCATTTAGAGCAGGG - Intergenic
989667096 5:43867250-43867272 CACCACCTTGAATTGGAGCAGGG + Intergenic
996400120 5:123053319-123053341 GTCCAACTTCACCTGGAGCTGGG - Intergenic
1001466128 5:171968117-171968139 CTCCACCTTCATTAGGAGAATGG - Intronic
1003096932 6:3149580-3149602 CCCCAACTTCATCAGCAGCAAGG + Intronic
1004323513 6:14652235-14652257 ATCTAACTTTATTTGGAGAAAGG + Intergenic
1006287007 6:33104383-33104405 CTCCAAATTTACTTGGAGTATGG - Intergenic
1006989067 6:38197792-38197814 CTCTAACTTGCTTTTGAGCAAGG - Intronic
1007749264 6:44062211-44062233 CTGCACCTTCACCTGGAGCAGGG + Intergenic
1009766074 6:68077299-68077321 ATCCACCTTCATTTGGGGAATGG - Intergenic
1009860989 6:69332011-69332033 CACCATCTTCATTGGCAGCAGGG + Intronic
1011897814 6:92253784-92253806 CTGCAACTTCATCTGGAGCTTGG + Intergenic
1013666223 6:112351596-112351618 TTCCAACTTCACTGGGAGTAGGG + Intergenic
1015678865 6:135781533-135781555 CTCCAACTTCAATGGCAGTATGG - Intergenic
1016707194 6:147122709-147122731 CTCAAACTTCATTTTCAACAGGG + Intergenic
1017121234 6:151025752-151025774 CAACGACTTCATTTGGTGCAGGG + Intronic
1018438817 6:163789175-163789197 AGGCAACTGCATTTGGAGCATGG - Intergenic
1022111107 7:27232340-27232362 CTCCAACTTTATTAGGAACCTGG + Intergenic
1024728136 7:52223564-52223586 CTCCAGCATCATTTGTAGAAAGG - Intergenic
1028315694 7:89399665-89399687 CTTCAACTTCCTTTGTAGAATGG + Intergenic
1028603666 7:92630822-92630844 CTGGAAGGTCATTTGGAGCAAGG + Intronic
1030123121 7:106130048-106130070 CTCCATCTTCAATAGGAGCTGGG + Intergenic
1030489211 7:110210724-110210746 CTCACACTCCAGTTGGAGCAAGG + Intergenic
1030930095 7:115512162-115512184 ATAGAACTTCATTTGGAGGATGG + Intergenic
1035792997 8:2325213-2325235 CTCCAACTCATTTTGAAGCAAGG - Intergenic
1035799807 8:2396492-2396514 CTCCAACTCATTTTGAAGCAAGG + Intergenic
1036101536 8:5792389-5792411 CTCCATCTTAATTAGGAGCAGGG + Intergenic
1036489955 8:9215617-9215639 GTCCAACATCATTTGGGGCAGGG - Intergenic
1038459750 8:27705709-27705731 CTACAACTTCCTTTGGAGCAGGG - Intergenic
1039151495 8:34511892-34511914 TTACCTCTTCATTTGGAGCAAGG - Intergenic
1042211957 8:66389869-66389891 CTCCAACCTCAGTTGGAGGCAGG + Intergenic
1043118406 8:76289559-76289581 TTCCTACTACATTTGGAGCTTGG + Intergenic
1046123841 8:109879713-109879735 TTCCATCTTCATTTGGAAAAAGG - Intergenic
1046368205 8:113265417-113265439 CTCCAGCTTCATTTCTAGCCAGG - Intronic
1050581085 9:7057886-7057908 CTCTTGCTTCATTTTGAGCACGG + Intronic
1051225609 9:14895955-14895977 CTCCAACTTGAATAGGAGCTGGG + Intronic
1055863201 9:80779764-80779786 CTCCAGCATCATTTGCAGAAAGG + Intergenic
1056054859 9:82811030-82811052 CTCCATCTTGATTAGGAGCTGGG + Intergenic
1057988924 9:99747195-99747217 CTCCATCTTGAATAGGAGCAGGG + Intergenic
1058048668 9:100384462-100384484 CTCCATCTTAATTAGCAGCAGGG + Intergenic
1062495359 9:136828965-136828987 CTCCCACTCCCTTTAGAGCATGG + Intronic
1186275509 X:7934276-7934298 TTCAGAGTTCATTTGGAGCAGGG + Intergenic
1188950349 X:36364978-36365000 TTCCAAATTAATTTGGAACAAGG - Intronic
1194739215 X:97552086-97552108 CACCAACTTCATTTCATGCAAGG - Intronic
1197173010 X:123455386-123455408 TTCCATTTTGATTTGGAGCAAGG - Intronic
1197801758 X:130356942-130356964 CTCCAGCTTCATCTGGAGATGGG - Intronic
1198454742 X:136805468-136805490 CTCCATCTTGAATAGGAGCAGGG + Intergenic