ID: 916549223

View in Genome Browser
Species Human (GRCh38)
Location 1:165833328-165833350
Sequence TGCCATGCCAAGAGTGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916549223_916549227 -4 Left 916549223 1:165833328-165833350 CCAGACCCACTCTTGGCATGGCA 0: 1
1: 0
2: 1
3: 6
4: 118
Right 916549227 1:165833347-165833369 GGCAGGCTTTCCCCCAGCCAAGG 0: 1
1: 0
2: 2
3: 21
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916549223 Original CRISPR TGCCATGCCAAGAGTGGGTC TGG (reversed) Intronic
900000444 1:12087-12109 AGCCATGCCTAGAGTGGGATGGG + Intergenic
900020158 1:182606-182628 AGCCATGCCTAGAGTGGGATGGG + Intergenic
900356776 1:2268745-2268767 GGCCATGACAGGAGTGGGTGTGG + Intronic
902951923 1:19891429-19891451 GGCCATGCCAAGAATGGATGGGG + Intronic
904481141 1:30794145-30794167 GGCCATGCCAAGTGTTGGTGAGG + Intergenic
905259961 1:36710131-36710153 TGCCCTGCCCTGAGTGGGTGGGG + Intergenic
905370726 1:37481426-37481448 TGCCACGCCAAGGGAGGGGCTGG + Intronic
905792410 1:40797239-40797261 AGCCATGCCCAGATTGGGGCAGG - Intronic
906679266 1:47714142-47714164 TACCATACCAGGACTGGGTCAGG + Intergenic
909868803 1:80711758-80711780 GGCCATGCCAAGTGTTGGTAAGG + Intergenic
913202027 1:116502701-116502723 TCCCAGGGCAAGAGTGGGGCAGG + Intergenic
915108036 1:153546519-153546541 TGCCATGCCAAGTAAGGCTCAGG + Intronic
915526304 1:156478388-156478410 TGCCATTCCCAGAGTGGTCCGGG - Intronic
916549223 1:165833328-165833350 TGCCATGCCAAGAGTGGGTCTGG - Intronic
917299542 1:173559290-173559312 TGCCTTTCCAAGACAGGGTCTGG + Intronic
917927881 1:179804019-179804041 TGACAAGACAAGAGTGGCTCTGG - Intronic
919020955 1:192105227-192105249 TGCCCTTCCAAGATTGTGTCTGG + Intergenic
919755079 1:201061627-201061649 GGCCATTCCAGGATTGGGTCTGG - Intronic
921200311 1:212799024-212799046 GGCCATGCAAAGAGAGGATCAGG + Intronic
922830257 1:228549375-228549397 TTCAATGCCTACAGTGGGTCAGG + Intergenic
1066463291 10:35631377-35631399 GGTCAAGCCAACAGTGGGTCAGG - Intergenic
1067148667 10:43711878-43711900 TGCTATGCCAAGAGGTGGGCAGG + Intergenic
1067189048 10:44054488-44054510 AGCTATGGGAAGAGTGGGTCAGG - Intergenic
1069263018 10:66422954-66422976 TGCTATGCCAAGAATAGCTCAGG + Intronic
1069594642 10:69662882-69662904 TGGCAAGGCAAGAGTTGGTCTGG - Intergenic
1072525349 10:96266450-96266472 AGCCATGCCCAGAGTGGGTGAGG + Intronic
1074359093 10:112811009-112811031 GGCCAAGCCAAGAGAGGCTCTGG - Intronic
1083952234 11:65963115-65963137 TGACATGAGAAGAGGGGGTCAGG + Intronic
1085307547 11:75496495-75496517 TGTCATCCCAAGAGGGGATCTGG - Intronic
1086098075 11:83070516-83070538 TGACATTCCAAGAGGGGGTGTGG + Intronic
1091005883 11:131953170-131953192 TGCCATGGCAACAGATGGTCCGG - Intronic
1091373536 12:12218-12240 AGCCATGCCTAGAGTGGGATGGG + Intergenic
1092609260 12:10154283-10154305 TGCCTTGCCAAGGGTTGTTCAGG + Intergenic
1095168550 12:39005055-39005077 TGTCATGCCAAGATTGTTTCAGG - Intergenic
1095948855 12:47770447-47770469 TGCCATGGCAAGAGAGGATGAGG - Intronic
1096940306 12:55336807-55336829 TACCATCCCAAGACTGGATCAGG - Intergenic
1098641119 12:72839336-72839358 TGTTAAGCCAAGAGTGGGGCAGG - Intergenic
1103367073 12:120391034-120391056 TGCCATGGGAAGAGGGGGGCAGG - Intergenic
1109205412 13:59477791-59477813 TGACATGCCCAGAGTGGGCATGG + Intergenic
1110534060 13:76630427-76630449 TGCCAAGCCAGGAGTGCATCTGG - Intergenic
1111900356 13:94192428-94192450 TGGAATGCCAAGAGTATGTCTGG + Intronic
1113469173 13:110532154-110532176 TGCCAGGGCAAGAGTGGGGCTGG + Intronic
1114707398 14:24741197-24741219 TGGCAGGCCCAGAGTGGGTGTGG - Intergenic
1117989548 14:61420247-61420269 GGCCAGGCCCAGAGTGGCTCTGG - Intronic
1120138480 14:80899591-80899613 TGCAATGCCAAAAGTCAGTCAGG + Intronic
1127683098 15:61316490-61316512 TGCCATGACAAGAGTGGGAGGGG - Intergenic
1129605001 15:77020571-77020593 TGCCATGCCCTGGATGGGTCAGG + Intronic
1132453063 15:101978858-101978880 AGCCATGCCTAGAGTGGGATGGG - Intergenic
1132453832 16:11768-11790 AGCCATGCCTAGAGTGGGATGGG + Intergenic
1135400431 16:22162888-22162910 AGCCATGTCCAGGGTGGGTCTGG + Intergenic
1139460889 16:67121493-67121515 TGCCTGGCCAAGAGTGGGCAGGG + Intronic
1139775542 16:69314766-69314788 GGCCCTGCCAAGAGCCGGTCAGG + Intronic
1140852652 16:78949248-78949270 TCCCAGGCAAAGAGTGGCTCAGG - Intronic
1141643032 16:85352528-85352550 TTCCAAGCCCACAGTGGGTCTGG - Intergenic
1143350634 17:6285625-6285647 TGCCATGCCAATTCTGGGCCTGG - Intergenic
1148468151 17:47877307-47877329 TGCCATGCCCTGAGAGGGGCTGG + Intergenic
1149535482 17:57430455-57430477 TGCCAGACCAGGAGTGGGGCAGG - Intronic
1149979897 17:61302128-61302150 TGGCATGGCAAGAGTGGGACAGG - Intronic
1151310130 17:73287762-73287784 TGCAGTGGGAAGAGTGGGTCTGG - Intronic
1156445712 18:37235368-37235390 GGCCCTGCAAAGAGTGGGCCAGG + Intergenic
1156824708 18:41417080-41417102 AACCATAACAAGAGTGGGTCTGG + Intergenic
1161209119 19:3057123-3057145 GGCCAGGCCAAGGGTGGGTAAGG + Intronic
1166676964 19:44746709-44746731 TGGGATGCCAGGAGTGGGACAGG + Intergenic
1168158569 19:54492821-54492843 TGCCATGCCAAGACTGGTCAAGG - Intergenic
926061670 2:9808551-9808573 TGGCATGCCAAGCCTGGGGCTGG - Intergenic
929565099 2:42979052-42979074 TGCCAGCCCAAGAGGGTGTCAGG + Intergenic
932044974 2:68339345-68339367 TGCCATGCCCAGAGAGGGTCTGG + Intergenic
935074148 2:99724190-99724212 TTCCATACCAAGAGGGGGTGTGG - Intronic
935421317 2:102871919-102871941 TGCCATACAGAGCGTGGGTCAGG + Intergenic
936569280 2:113601330-113601352 AGCCATGCCTAGAGTGGGATGGG - Intergenic
939883792 2:147659161-147659183 TGCCATGTAAACAGTGGGTTTGG - Intergenic
942702437 2:178728926-178728948 TGTCAAGCCAAGAATGAGTCAGG - Exonic
944116176 2:196188955-196188977 TGCCATGCCTAGAAAGGTTCTGG - Intergenic
947378385 2:229520956-229520978 TCCTATGCCAAGGGAGGGTCTGG + Intronic
1171023708 20:21609751-21609773 TGCCATGACCACAGTGGGTTGGG + Intergenic
1173537992 20:43830378-43830400 TTCCATGCCCAGTGCGGGTCTGG + Intergenic
1173640921 20:44601314-44601336 TGCCATTCAAAGAGTGGCCCTGG - Intronic
1174548683 20:51345416-51345438 TGCCATTCCCTGAGTGGGTTGGG - Intergenic
1174860464 20:54086473-54086495 GTGCATGCCAAGAGTGGGGCAGG - Intergenic
1177732749 21:25049444-25049466 TTCCATGCGAAGGGAGGGTCGGG - Intergenic
1178728693 21:35079005-35079027 TGCCATGCCAAGACATGGGCTGG - Intronic
1182619318 22:31610152-31610174 TGGCAGGCCAAGGGTGGGACTGG + Intronic
1184093664 22:42305300-42305322 TGCCATGCCCTGAGGGGGGCAGG - Intronic
1184359208 22:44004019-44004041 TTCCATCCCAAGAGTGGGGAAGG - Intronic
1184880357 22:47300596-47300618 TGTCCTCACAAGAGTGGGTCAGG - Intergenic
1185050534 22:48551860-48551882 TCCCATGGCAAGTGTGGGTGTGG + Intronic
956080722 3:65552790-65552812 TGTCATGTCAAGAGTGGCTGTGG - Intronic
961653352 3:128428459-128428481 TGCCAAGCCCAGAATGGCTCTGG - Intergenic
963466020 3:145684551-145684573 TGCGTTGCGAAGGGTGGGTCCGG - Intergenic
967423668 3:189301689-189301711 CTCCAGGCCAAGAGTGGGGCTGG - Intronic
967886614 3:194337775-194337797 CATCATGCCAAGTGTGGGTCAGG + Intergenic
969463065 4:7338980-7339002 TGCCCTGCCAGAAGTGTGTCAGG - Intronic
970758775 4:19457137-19457159 TCCCATGTCATGAGTGTGTCAGG + Intergenic
971422389 4:26485545-26485567 TGCCTTGCCCAGAGTGGTTGGGG - Intronic
971911026 4:32798126-32798148 TGCCATGGCAACACTGGGTTGGG + Intergenic
974129650 4:57738031-57738053 TGCTAGACCAATAGTGGGTCAGG + Intergenic
979524749 4:121705286-121705308 TGCCATGCCTGGAGAGGGCCTGG - Intergenic
980597686 4:134976013-134976035 TGCCTGGAAAAGAGTGGGTCTGG - Intergenic
981646944 4:147009687-147009709 TGCCATGCAAAGTGTGGGCACGG - Intergenic
982496396 4:156098843-156098865 TCCCATGGCAAGTGTGGGGCCGG + Intergenic
985564122 5:606781-606803 TGCTATCCCAGGACTGGGTCAGG - Intergenic
988385253 5:30554817-30554839 TATCTTTCCAAGAGTGGGTCTGG - Intergenic
999289541 5:150414783-150414805 TGCCATGTGAGGAGAGGGTCGGG + Intergenic
1000049012 5:157546095-157546117 TGCCAAGCCAGGAGAGGGGCAGG - Intronic
1007970588 6:46048403-46048425 TCCCATGCTAAGACTGGGTTAGG - Intronic
1011629652 6:89311531-89311553 TGCCCTGCCATGGGTGGGTGGGG - Intronic
1019595914 7:1858328-1858350 TGTCATGCCCAGAGTGGGCCAGG - Intronic
1022469084 7:30670932-30670954 TTCCATGCCCAGAGTGGCCCAGG + Intronic
1025071320 7:55901655-55901677 TGCCATGCCCAGAGAGGGCATGG + Intronic
1026583720 7:71638718-71638740 TGCCATCCAAAGAGTAGGTGAGG + Intronic
1028987180 7:97017738-97017760 TGCGATGTCAAGAGTGGGGCCGG + Intergenic
1029896740 7:103990729-103990751 TGGCAAGCCAAGGGTGGGTGGGG - Intergenic
1033713724 7:143977499-143977521 TGCCTAGCCAAGAGTGCTTCAGG + Intergenic
1038165933 8:25085098-25085120 TGCCCTGCCTAGACTGGCTCTGG - Intergenic
1040404865 8:47089719-47089741 TGCCATGCTAAGACTGGAACTGG - Intergenic
1047698739 8:127429418-127429440 TGCCATGCCAAGAAATGGCCTGG - Intergenic
1048220347 8:132535201-132535223 TGCCATGACAAGGGTGGGGTGGG - Intergenic
1049883248 9:12200-12222 AGCCATGCCTAGAGTGGGATGGG + Intergenic
1051791334 9:20806084-20806106 TGACATGGCAAGAGTGGTCCAGG - Intronic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1059193535 9:112349257-112349279 TGGCATGCCCAGAGAGGGTATGG + Intergenic
1059699130 9:116758359-116758381 TGCCATGCCAGGAGAGTGCCAGG + Intronic
1188520747 X:31034836-31034858 AGCCATGCTAAGAGTGGGAAAGG - Intergenic
1192334238 X:70204286-70204308 TGCCCTGCAAAGAGAGGGGCAGG - Exonic
1198216278 X:134557763-134557785 TCCACTGCCAAGGGTGGGTCAGG - Intergenic
1200402565 X:156027948-156027970 AGCCATGCCTAGAGTGGGATGGG - Intergenic