ID: 916549930

View in Genome Browser
Species Human (GRCh38)
Location 1:165840212-165840234
Sequence TTTTAAAGGCTGACCAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 338}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916549930 Original CRISPR TTTTAAAGGCTGACCAGGCC GGG (reversed) Intronic
901393786 1:8965590-8965612 TTTTAAAGGCTGAAGTGGCTGGG + Intronic
901823462 1:11845378-11845400 ATTTAAAAGCTGAGCAGGCCGGG - Intergenic
902057041 1:13609769-13609791 TTTTTAAAGCTGAACAGGCTGGG + Intronic
902412658 1:16220510-16220532 TTTTAGAGGAAGAACAGGCCAGG + Intergenic
902633108 1:17717630-17717652 ATTTAAAGGCAAACCAGGCTGGG - Intergenic
903167051 1:21527837-21527859 TGTTAAAGGCTGGCCGGGCGTGG - Intronic
903194415 1:21674094-21674116 TTCTAAAGTCAAACCAGGCCAGG + Intergenic
903411015 1:23142868-23142890 TTTTAAAGAATGAATAGGCCAGG + Intronic
904156295 1:28486059-28486081 TTTAAAAGACTGACAAGGCCGGG + Intronic
904629071 1:31828059-31828081 TTTTAAAGATTAGCCAGGCCTGG - Intergenic
905225922 1:36479206-36479228 TTTTCCAGGATGACCAGCCCGGG + Intronic
905515082 1:38556734-38556756 TTTGAAGGGCTTACCAGTCCTGG + Intergenic
905652215 1:39664109-39664131 ATTTATAGGTTTACCAGGCCTGG - Intronic
905805158 1:40871283-40871305 TTTTAAATTGTGACTAGGCCAGG - Intergenic
905925150 1:41744332-41744354 TTTAAAAGGCTGGCTGGGCCAGG - Intronic
906445628 1:45895350-45895372 TTTTATGGGCTGACCAATCCCGG - Intronic
906969881 1:50501367-50501389 TTTAAAAGACTAACCAGGCCAGG + Intronic
907575633 1:55523284-55523306 TTTTCAAGGCTTTCCTGGCCTGG - Intergenic
909599397 1:77445873-77445895 TAGGAAAGGCTGACCAGGCGTGG - Intronic
910593682 1:88955054-88955076 TTTTAAATGCTGGCCAGGCATGG - Intronic
911588114 1:99714475-99714497 TTTTAAATGTAAACCAGGCCGGG - Intronic
912315578 1:108664796-108664818 TTTAAATGGCTCACCGGGCCTGG - Intergenic
912763915 1:112391696-112391718 TTTTAAAATCAGTCCAGGCCGGG + Intergenic
913431685 1:118801449-118801471 TTTTAAAGGCTGTACATGCTTGG - Intergenic
913487337 1:119343997-119344019 TTTTAAAGCCAAACCAGGCATGG + Intergenic
915565277 1:156709467-156709489 TTTTCAAGTCTGAGAAGGCCAGG + Intergenic
916324344 1:163540386-163540408 TTTTGAAGGGTGAGCAGGGCAGG - Intergenic
916549930 1:165840212-165840234 TTTTAAAGGCTGACCAGGCCGGG - Intronic
917822137 1:178773943-178773965 TTTTAAAAGCAGAGAAGGCCAGG + Intronic
918211979 1:182359197-182359219 TTTTTAAGAGTGTCCAGGCCAGG - Intergenic
921202573 1:212821592-212821614 ATTTAAAAACTCACCAGGCCTGG + Intergenic
921224943 1:213009753-213009775 TTTTAAAGTATGATTAGGCCAGG + Intronic
921273622 1:213494815-213494837 TTGTAAAGGCTGACTATTCCAGG + Intergenic
921689387 1:218130479-218130501 TTTAAAAGCCTGTCCAGGCCAGG - Intergenic
922181489 1:223237656-223237678 TTTTAAATGCTGAACCAGCCTGG + Intronic
922295190 1:224243952-224243974 TTTAAAAGAGTGACAAGGCCGGG - Intronic
922711951 1:227841065-227841087 TTATAAAGAGTGAGCAGGCCTGG + Intronic
922886906 1:229027411-229027433 TTTAACAGGCTGCCCAGGCCCGG + Intergenic
923576012 1:235159572-235159594 TTTAAAAAGCAAACCAGGCCAGG + Intronic
923677080 1:236089212-236089234 CATTAAATGCTTACCAGGCCAGG + Intergenic
923802598 1:237225118-237225140 TTTTGAAGTCTGAGTAGGCCAGG + Intronic
924292166 1:242547877-242547899 TTTTAAAAGTTGGCCAGGCGTGG + Intergenic
924685853 1:246288820-246288842 TTTAAAAGCCTGGCCAGGCACGG + Intronic
1063130062 10:3170698-3170720 TTAGAAAGGCTGAAGAGGCCGGG + Intronic
1063591048 10:7395937-7395959 ATTAAAAGGCTGACTGGGCCAGG + Intronic
1063977717 10:11430410-11430432 TCTGACAGTCTGACCAGGCCAGG + Intergenic
1064346369 10:14536465-14536487 CTTTTCAGGCTGACCCGGCCTGG - Intronic
1064406928 10:15072220-15072242 TTTTAAAAGCTGGCCAGGCATGG - Intronic
1065221305 10:23498909-23498931 CTTCAAAGGCTGCCCAGGCTGGG - Intergenic
1065351810 10:24802572-24802594 TTTTAAAAATTAACCAGGCCTGG - Intergenic
1066423367 10:35282430-35282452 TTTAAAAATCTGAACAGGCCAGG + Intronic
1066668366 10:37810073-37810095 TTTTAAATGCAGACCAGGTCTGG + Intronic
1067684295 10:48457706-48457728 TGCTAAAGCCTCACCAGGCCTGG - Intronic
1069091950 10:64210126-64210148 TTTTAAAGCCTGACAAAGCATGG - Intergenic
1070653003 10:78251692-78251714 TTTTAAAGGCAGACAAACCCTGG - Intergenic
1074329909 10:112496060-112496082 CTTTAAAGCCTGACTTGGCCAGG + Intronic
1074598005 10:114885097-114885119 TTTTAAAAGGTGACCCGGCCTGG + Intronic
1075042782 10:119121746-119121768 TTTTAAAGAAGGACCTGGCCGGG - Intronic
1075148260 10:119902059-119902081 TTTTAAAGGTTAAATAGGCCGGG + Intronic
1076176030 10:128368461-128368483 TTTTAAAAACAGACCAGGCGCGG - Intergenic
1077040360 11:518470-518492 TTTAAAAAGCTGACCTGGCGCGG - Intergenic
1079141726 11:17815301-17815323 TTTTAAAAACTGACCTGGCCGGG + Intronic
1083978880 11:66148434-66148456 TTTTAATGGCAGGCCAGGCATGG - Intronic
1084002159 11:66301980-66302002 TTTTAAAGAAAGAACAGGCCAGG - Intergenic
1084058768 11:66655573-66655595 TTTTAAAAGAGGCCCAGGCCGGG - Intronic
1084078325 11:66799782-66799804 TTTTAAAGGCTGACTAGGCTGGG + Intronic
1084602431 11:70154119-70154141 CTTTAGAGGCTGACAAGGCCAGG - Intronic
1085008709 11:73119740-73119762 TTTAAATGGCTGTCTAGGCCAGG - Intronic
1085123805 11:73983658-73983680 AATTAAAGGCGAACCAGGCCCGG - Intergenic
1085984313 11:81766742-81766764 TATCAGAGGCTAACCAGGCCTGG - Intergenic
1086368428 11:86132157-86132179 TTCTTAAGAATGACCAGGCCCGG - Intergenic
1086479621 11:87220429-87220451 TTTTGAAGACTGAGAAGGCCAGG + Intronic
1087380774 11:97401874-97401896 TTATAAAAACTAACCAGGCCAGG - Intergenic
1090127114 11:124098517-124098539 TCTTAAAGGCTGAATCGGCCAGG + Intergenic
1090754047 11:129773086-129773108 TTTTAAATGCTGATTAGACCTGG - Intergenic
1090819731 11:130330942-130330964 TTTTAAAAGCTGGCCAGGCATGG + Intergenic
1091111989 11:132978239-132978261 TTTTAAAGGCTTCCCAAGCTTGG - Intronic
1091739060 12:2946950-2946972 TTTTAAAGTGTGTCTAGGCCGGG + Intergenic
1092136369 12:6150761-6150783 ATATAAAAACTGACCAGGCCGGG + Intergenic
1092621348 12:10273990-10274012 TTTTAAATGTTGGCCAGGCATGG + Intergenic
1093876054 12:24350637-24350659 GGTTAAAAGCTGACCAGGCCAGG - Intergenic
1094459360 12:30677844-30677866 TTTTAAAGTTTGGCCAGGCGTGG + Intronic
1095475140 12:42579242-42579264 TTTTACAGGGTGACCAGGGAAGG + Intronic
1096280310 12:50246973-50246995 TTTTAAAACATGTCCAGGCCAGG + Intronic
1096289432 12:50328818-50328840 TTTTAAAACATGTCCAGGCCGGG + Intronic
1096388843 12:51213845-51213867 TTTAAAATGGTGACTAGGCCAGG + Intronic
1096699342 12:53371823-53371845 TTTTAAATGCTGAGCTGGGCCGG + Intergenic
1096723548 12:53542580-53542602 TTTTAAAGATTGATCAGGCATGG - Intronic
1097819567 12:64114644-64114666 TTAAAAATGCTAACCAGGCCAGG - Intronic
1099308967 12:80994258-80994280 TTTTCAAGGCTAACCTGGCCAGG + Intronic
1099680393 12:85820831-85820853 TTTTAAAGGCTGAACAAGTTGGG - Intronic
1100327049 12:93549798-93549820 TTTTCAAGACTGCCCAGGCTGGG + Intergenic
1100802727 12:98250294-98250316 TTATTAAGAATGACCAGGCCGGG - Intergenic
1101583806 12:106067154-106067176 ATTTCAGGGCTGACCAGGGCTGG + Exonic
1102311836 12:111851191-111851213 TTTAAAAGGCAGTCCTGGCCGGG - Intronic
1102483145 12:113237719-113237741 TTTCATAGGCTCACCTGGCCTGG + Intronic
1103787697 12:123445685-123445707 TTCAAGAGGCTGACCACGCCTGG + Intergenic
1105787950 13:23768423-23768445 TTTAAAATGTTGACCAGGCACGG + Intronic
1107944639 13:45406969-45406991 ATCTAAAGGCTGGCCAGGCACGG + Intronic
1108762987 13:53592606-53592628 TTGAAAAGGCAGTCCAGGCCGGG - Intergenic
1109250978 13:60020658-60020680 TAATAAAGGCTGACTTGGCCAGG - Intronic
1109514901 13:63430195-63430217 TTTGAAAGGTTGGCCAGGCATGG - Intergenic
1110478849 13:75950201-75950223 ATTTAAAGTCAGACCAGTCCAGG - Intergenic
1112377568 13:98857579-98857601 AGTTAAAGACTGACCAGGCACGG - Intronic
1113067762 13:106389167-106389189 TTTTAAAGGATGAACAGGTATGG + Intergenic
1113198390 13:107836284-107836306 GTTTAAAGTCAGACTAGGCCAGG - Intronic
1113281695 13:108795496-108795518 TTTTAGAAGCTGGCCAGGCGCGG - Intronic
1114912838 14:27221517-27221539 TTTAAAAGGAGGAACAGGCCGGG + Intergenic
1115056709 14:29136651-29136673 TCTGAAAGGCTGAACTGGCCTGG + Intergenic
1115253302 14:31372531-31372553 TTTTAAAGTCAGACTGGGCCAGG + Intronic
1115848382 14:37564149-37564171 TTTTAAAAGCTGAACAGTCCAGG - Intergenic
1115951432 14:38726879-38726901 CTTTAAATGCTCACCAGCCCAGG + Intergenic
1117084540 14:52185818-52185840 TTTTAAAGGCAGGCCAGTCACGG - Intergenic
1117682966 14:58224295-58224317 TTTAAAAAGCTGAATAGGCCGGG - Intronic
1118031113 14:61818785-61818807 TTTGAAAAGCTGACTAAGCCTGG + Intergenic
1118085953 14:62417455-62417477 TTTTAAAATCAGACCTGGCCAGG - Intergenic
1118358752 14:65038053-65038075 TTTAAAAGGCTGGCCAGGTGCGG - Intronic
1118503559 14:66386779-66386801 TTTTAAAAGTTGAATAGGCCGGG + Intergenic
1118853729 14:69605245-69605267 TTTTAAAGGGGGACCAGAGCAGG - Intergenic
1121076240 14:91071040-91071062 GTCTAAAGGCTGACCAGGTGTGG + Intronic
1121680868 14:95791770-95791792 TTTTCTAGGCTGGGCAGGCCTGG - Intergenic
1122596502 14:102896912-102896934 TTTTAAAGCCTAACCAGACATGG + Intronic
1124139083 15:27061800-27061822 TTTTAAAGGGTATCCGGGCCTGG + Intronic
1125554377 15:40572138-40572160 TTTAAAATGCTGACAAGGCCAGG + Intronic
1125568247 15:40694342-40694364 TTTTAAAGGCTGAGTAGGGCCGG - Intergenic
1125654119 15:41341841-41341863 CTTTAAAGGCTTACAAGGCCTGG + Intronic
1125869250 15:43083750-43083772 TTTAAAAGGCTGGCCAGGCTTGG + Intronic
1126195089 15:45922564-45922586 TTAGAAAGGCTGTTCAGGCCAGG - Intergenic
1130219293 15:82004806-82004828 TTTTAAAGACAGATTAGGCCAGG - Intergenic
1130336598 15:82962073-82962095 TTTTAAAAAATGTCCAGGCCGGG + Intronic
1131086589 15:89580736-89580758 TTTTAAAAGCAGTCTAGGCCAGG + Intronic
1132355110 15:101165731-101165753 TTTTAAAGTCTGGCCAGGTGTGG + Intergenic
1132935372 16:2477814-2477836 TTTTGAAGGATGATCAGGACCGG + Intronic
1133192847 16:4147144-4147166 TCTGAAAGGCAGGCCAGGCCCGG - Intergenic
1134098770 16:11436887-11436909 TTTTAAAACCTTTCCAGGCCAGG - Intronic
1136371388 16:29838671-29838693 TTTTAAAAATTGACCAGGCATGG + Intronic
1136488917 16:30592085-30592107 TTTAAAAGGCAGTCCCGGCCGGG - Intergenic
1136634484 16:31510987-31511009 TTTTAAAAGTTGGCCAGGCATGG - Intergenic
1137754593 16:50891435-50891457 TTCTCAAGGCTCACCTGGCCTGG - Intergenic
1139378422 16:66515262-66515284 GTTTAGAGGCTGCCCAGGGCTGG - Intronic
1139685258 16:68598431-68598453 TAGAAAAGGCTTACCAGGCCGGG + Intergenic
1139706719 16:68746130-68746152 TTTTAAAAGCTCCTCAGGCCAGG + Intronic
1141961968 16:87414783-87414805 TTTAAAAGCATGACTAGGCCAGG + Intronic
1144081428 17:11767526-11767548 GTTTAAAGGCTGAAGAGACCAGG - Intronic
1144180312 17:12745502-12745524 ATTTAAAGGGTGACCTGGCCAGG - Intronic
1144873949 17:18387192-18387214 ATTAAAAAACTGACCAGGCCAGG - Intronic
1145158521 17:20558595-20558617 ATTAAAAAACTGACCAGGCCAGG + Intergenic
1146047422 17:29520727-29520749 TTTAATTGGCTGAGCAGGCCGGG + Intronic
1146306828 17:31736370-31736392 TTTTAGAGGAAGACAAGGCCGGG + Intergenic
1147469378 17:40644946-40644968 TTTTACATGCTGACCAAGCTGGG + Intronic
1147866402 17:43555584-43555606 ATTTAAAATCTCACCAGGCCGGG - Intronic
1148988049 17:51640737-51640759 TTTTCAGGGCTAACTAGGCCAGG + Intronic
1149824829 17:59818473-59818495 TTTAAAAGGCTAAACTGGCCAGG + Intronic
1151087471 17:71397534-71397556 ATATAAAGACTGAACAGGCCAGG + Intergenic
1151606354 17:75139523-75139545 TTTAAATGTCTGTCCAGGCCAGG + Intronic
1151942059 17:77298972-77298994 TTTTAAAGCCAGCCTAGGCCAGG - Intronic
1152119409 17:78408977-78408999 TTTCAACGGCTGACAAGGCCGGG - Intronic
1152887005 17:82858440-82858462 TTTTAAATGCCGAATAGGCCTGG - Intronic
1153371204 18:4318055-4318077 TTTGAGAGGCTGAGAAGGCCTGG - Intronic
1154274387 18:12947274-12947296 TTTTACAGGTAGAACAGGCCTGG - Intronic
1155904815 18:31437221-31437243 TTCAAAAGGCTAACCAGGACAGG - Intergenic
1156330547 18:36117734-36117756 TTTTAAAGGCAAACACGGCCGGG + Intronic
1157660096 18:49433917-49433939 TTTTAAATGGTGGCCAGGCGCGG + Intronic
1157814765 18:50722542-50722564 TATTCAAGGCTCAGCAGGCCTGG + Intronic
1158906756 18:62020657-62020679 TTTTAAAGACTGGCCGGGCGCGG + Intergenic
1161346059 19:3769381-3769403 TTTTAAAGCTAAACCAGGCCAGG - Exonic
1161390516 19:4018106-4018128 TTTAAAAGGCTGACTGGGGCCGG - Intronic
1162371498 19:10282715-10282737 TTTTAAAGAATGTCTAGGCCAGG + Intronic
1162498112 19:11034747-11034769 TTTCAGTGGCTGACCTGGCCTGG - Intronic
1162884670 19:13687659-13687681 TTAAAAGGACTGACCAGGCCAGG - Intergenic
1163694682 19:18758065-18758087 TTTAAAAGGCGGAAGAGGCCAGG + Intronic
1164994879 19:32713454-32713476 TTTAAAATGCTAACTAGGCCAGG - Exonic
1165977476 19:39689376-39689398 TTAGAAAGGTTGACCAGGCATGG + Intergenic
1167025815 19:46917310-46917332 CTTTAAAGGCTGAATAGGCCAGG + Intergenic
1167590293 19:50400989-50401011 TTTTAAAAGTTAGCCAGGCCGGG - Intronic
1167734440 19:51283432-51283454 TTTAAAAGGTAGACAAGGCCAGG - Intergenic
926169867 2:10546187-10546209 TTTTAAAGGTTGAATAGGCCAGG + Intergenic
927031154 2:19121777-19121799 TTCTAAAGGGTGCCCAGGCATGG - Intergenic
927629365 2:24758624-24758646 TTATAAAGTCTGTCAAGGCCAGG - Intronic
927820566 2:26260374-26260396 TTTTAAAAACTAACCAAGCCAGG - Intronic
928569912 2:32596186-32596208 TTTAAAAAACTGACCTGGCCGGG + Intronic
928702530 2:33913711-33913733 TAATAAAGTCTGACAAGGCCAGG - Intergenic
929497340 2:42457554-42457576 TTTACAAGGCTGGCCAGGCACGG + Intronic
930027265 2:47036700-47036722 TTTTAAAAGTTAACCAGGCGTGG + Intronic
930940298 2:57004324-57004346 TTTTAAAAGCTAAGCAGGCTGGG - Intergenic
931362423 2:61589207-61589229 TATTAAAAGATGTCCAGGCCAGG - Intergenic
931897251 2:66745828-66745850 TTTAAAAGGCTGCTTAGGCCTGG + Intergenic
932542835 2:72674534-72674556 TTTAAAAGGCTGTGCAGGCCGGG + Intronic
932962683 2:76432484-76432506 TTTTAAAGAATAACCAGGCCAGG - Intergenic
935256665 2:101315595-101315617 TGTAAAGGGCTGCCCAGGCCTGG - Intergenic
935411332 2:102767295-102767317 TTTGAATGACTGGCCAGGCCTGG + Intronic
935888246 2:107648206-107648228 TTTTAAAAGTATACCAGGCCGGG - Intergenic
936267743 2:111023316-111023338 TTTTAAACGCTGCCCTGGACAGG + Intronic
936592226 2:113815222-113815244 TTTAAAAGCATGGCCAGGCCTGG + Intergenic
937342992 2:121103863-121103885 TTTTAAAGGGTGCCCAAACCAGG + Intergenic
937989932 2:127656708-127656730 TTTGAAAAGGTGACCTGGCCGGG - Intronic
938186701 2:129238558-129238580 TTCTAAAGGCTGGCAAGTCCAGG - Intergenic
938408077 2:131043772-131043794 TTTCACAGTCTGACCAGGCCGGG + Intronic
938961249 2:136343559-136343581 TTTTAAAGGCTCCCCAGGCCGGG + Intergenic
941280192 2:163540253-163540275 TTTTAAAAGTTGAATAGGCCAGG - Intergenic
941949119 2:171134894-171134916 TTTTTAAGGCTGAATAGGTCCGG - Intronic
942957536 2:181790995-181791017 TTTTAGATACTGACAAGGCCAGG + Intergenic
943366845 2:186974570-186974592 TTTTAAAAGCAGGCCAGGCGTGG - Intergenic
945631921 2:212288649-212288671 CTTTGAAGGGTGACCAGGACAGG - Intronic
946370102 2:219276173-219276195 TTTAAAAGTCACACCAGGCCGGG + Intronic
946473249 2:219982539-219982561 TTTAAAATGCTGGCCAGGCGCGG + Intergenic
1169701754 20:8454739-8454761 TTTAAAAGGCTGCCCAGGGAAGG - Intronic
1169933641 20:10859725-10859747 TTTTAAAGGTTGAGGAGGTCAGG - Intergenic
1170732672 20:18988240-18988262 TGCTACATGCTGACCAGGCCCGG + Intergenic
1171981997 20:31634899-31634921 TTCTAAAGGCTGGCCAGGCATGG - Intergenic
1171991251 20:31698181-31698203 TTTTAAAGGATCACCAGGCTGGG - Intronic
1172036814 20:32016855-32016877 TTTTAAAAGTTGGCCAGGCATGG + Intronic
1172201455 20:33129520-33129542 TATTGAAGGTTGACCAGTCCAGG - Intergenic
1172464050 20:35142271-35142293 TTTTAAGGACTGACCATGCCAGG - Intronic
1172478795 20:35258881-35258903 TTTAAAAGGCTCCCCGGGCCAGG + Intronic
1172567655 20:35943359-35943381 ATTTAAAAGCTGACCTGGCGTGG + Intronic
1172824245 20:37767007-37767029 AGTTAAAGGATGACCAGGCAGGG - Intronic
1172902818 20:38347246-38347268 TTTTAAAGAATGGGCAGGCCAGG + Intronic
1173093109 20:39994741-39994763 TCTTAAAGGCTGAATAGCCCAGG + Intergenic
1173606486 20:44335737-44335759 TTTTAGATACTAACCAGGCCTGG + Intergenic
1175027022 20:55913440-55913462 TTTTAAAGGCAGAGAAGGCCAGG + Intergenic
1175145675 20:56894474-56894496 TTTTGAAGGCTGAGAAGTCCAGG + Intergenic
1176048278 20:63103593-63103615 TTTTAGAGGGTTTCCAGGCCTGG - Intergenic
1176064821 20:63188914-63188936 TTTTGCAGGTGGACCAGGCCGGG - Intergenic
1176104299 20:63378565-63378587 TAATAGAGGCTGGCCAGGCCCGG - Intergenic
1177430119 21:20981813-20981835 TTTTAAAGGCACATCAGGCTGGG - Intergenic
1179436746 21:41367673-41367695 TTTCAAGCGGTGACCAGGCCAGG - Intronic
1179453132 21:41479019-41479041 GATTAGAGTCTGACCAGGCCTGG - Intronic
1180213891 21:46312663-46312685 TTAAAAAGACTGACCAGGCCGGG - Intronic
1182185768 22:28400316-28400338 TTTGAAATGCTGAGCAGGACTGG - Intronic
1182743618 22:32587618-32587640 CTCCAAAGGCCGACCAGGCCCGG + Intronic
1182851035 22:33474456-33474478 TTTAAAAGACAGACTAGGCCGGG - Intronic
1182864406 22:33590905-33590927 TTTAAAAAGCTGCCAAGGCCGGG + Intronic
1182934838 22:34211028-34211050 ATATAAAGGCAGAACAGGCCAGG + Intergenic
1183901162 22:41007070-41007092 TTTTAAAGGCTAACCCAGCCTGG + Intergenic
1184078414 22:42199572-42199594 TTTAAAAGTCTAAACAGGCCAGG + Intronic
1184324014 22:43768252-43768274 TTTTAATGACTGACCAGGGCAGG - Intronic
949950033 3:9221376-9221398 TTTTAAAAGTTAGCCAGGCCTGG + Intronic
951819797 3:26795481-26795503 TTCTAACCTCTGACCAGGCCAGG - Intergenic
952292561 3:32031993-32032015 ATCTTAAGGCTGACCAGGCATGG + Intronic
952672689 3:35989716-35989738 TTTTAAAGATTGGCCAGGCATGG - Intergenic
954014105 3:47670893-47670915 TTTCAAAGACTGGCCAGGCGTGG + Intronic
954180252 3:48876045-48876067 TTTTAAAGCCAATCCAGGCCAGG + Intronic
954329880 3:49884244-49884266 TAATAAAGGCTGAGCAGGCCAGG - Intergenic
955971193 3:64440261-64440283 TTTTAAAGCTTGACAATGCCAGG - Intronic
956682356 3:71792511-71792533 TTTTAAAACCAGAGCAGGCCAGG - Intergenic
956758987 3:72420867-72420889 TTTTAAAGGCTCCCTAGGGCTGG + Intronic
957261561 3:77908757-77908779 TTTTAAAAGTAGACCAGGCATGG + Intergenic
957679158 3:83409101-83409123 TTTTAAAGGCAAAAGAGGCCAGG - Intergenic
959179159 3:102956386-102956408 TTTGAAAGACTGACCGGGCGTGG - Intergenic
959772953 3:110121969-110121991 TTTTAAAGATTGCTCAGGCCAGG + Intergenic
960586594 3:119325892-119325914 TTTTAAAAGCTTCCCAGGGCTGG + Intronic
960802351 3:121552286-121552308 TTCTGAAGGCAGACCAGGCAAGG - Intergenic
960865097 3:122191600-122191622 TTTTAAACGTTGGCCAGGCATGG - Intronic
961157459 3:124692172-124692194 TTTTTAAGGCTGCCCAGGTCAGG + Intronic
962788554 3:138789982-138790004 TTTTAAAGGCTGAATAGGCTGGG - Intronic
963506401 3:146190487-146190509 TTTTAAAGTCTATCCTGGCCCGG + Intergenic
964206146 3:154177445-154177467 TGTTAAAGGCTGTGCAGGACTGG + Intronic
964245200 3:154643709-154643731 TTTGAAAGGCTGAAGAGGGCAGG + Intergenic
969061729 4:4440963-4440985 TCTGAAGGGCTGACCAGGGCTGG + Intronic
969652615 4:8476897-8476919 TTTTAAAAGTTGGCCAGGCATGG - Intronic
972323419 4:37993097-37993119 ATTTAAAGAATCACCAGGCCGGG - Intronic
972584272 4:40422238-40422260 TTTTAGAGGCTGAACAGACTGGG - Intergenic
973318426 4:48785266-48785288 TTTTAAAGCCAGACCAGGTGTGG + Intergenic
973986819 4:56362558-56362580 TCTTAAATGCTGTCAAGGCCAGG - Intronic
977061234 4:92259141-92259163 TTTTATAGGCAGATCAGGCTGGG - Intergenic
977500101 4:97827528-97827550 TGTTAAAAGCTGTCTAGGCCGGG - Intronic
977903476 4:102449372-102449394 TTTTAAAGTGTAAACAGGCCAGG - Intergenic
978818787 4:112939608-112939630 TTTTAAAGAATGAACTGGCCGGG - Intronic
979319463 4:119305359-119305381 TTTGAAAGGCTGAACAGAACTGG + Intergenic
979955949 4:126954538-126954560 TTTTACAGGCTAGCCAGGCTTGG + Intergenic
981431624 4:144668020-144668042 TTTGAAAAGCAGATCAGGCCAGG + Intronic
982167475 4:152627870-152627892 TTCTTAAGGGTGACCAGACCTGG + Exonic
983574031 4:169240933-169240955 TTTTTAAAACTGCCCAGGCCGGG + Intronic
984554423 4:181197171-181197193 TTCTAAAGGCAGATGAGGCCTGG - Intergenic
985309266 4:188579360-188579382 TTTCAAAGACAGACCAGGCTTGG + Intergenic
986331219 5:6717250-6717272 TTTTAAAGGCTCACCTGGGCTGG + Intronic
988298493 5:29393670-29393692 TTATTAAGGCTGCCCATGCCAGG - Intergenic
988334482 5:29888141-29888163 TTATATAGGCTGACAAGTCCAGG + Intergenic
988943278 5:36167911-36167933 TTTTAAAGGGAGACCAGGCTGGG - Intronic
989325120 5:40183519-40183541 TTCTACAGGCTGGCCAGGCATGG - Intergenic
991035357 5:62122801-62122823 GTATAAAGGCTGACCAGCCCCGG + Intergenic
991044006 5:62204217-62204239 TTTAAAATGCTGGCCAGGCTTGG + Intergenic
991370010 5:65908605-65908627 TTTTAAAAACTGATTAGGCCAGG - Intergenic
991370988 5:65919589-65919611 TTTTAAAGTCAGAGTAGGCCAGG - Intergenic
992356797 5:75994057-75994079 TTTATAAGGCTGACAAGGACTGG + Intergenic
992536103 5:77705529-77705551 TCATAAAGGCGGACAAGGCCAGG + Intronic
992795371 5:80251121-80251143 TTTTAAAAACTGGCCAGGCATGG + Intronic
992868126 5:80978485-80978507 TTTTAAAGGGGGACAAGGCCAGG + Intronic
993630175 5:90277116-90277138 TTTTAAAATGTAACCAGGCCTGG + Intergenic
993966175 5:94363710-94363732 TTTTAAAAACTAACCAGGCATGG + Intronic
994373760 5:98995315-98995337 TTTTAAAGTATGCTCAGGCCAGG + Intergenic
997547820 5:134724291-134724313 TTTTAAAGGCTGAAGTCGCCGGG + Intronic
997924494 5:138016309-138016331 TTTTAAATGAAAACCAGGCCAGG + Intronic
997938093 5:138132038-138132060 TTTTAAAAGCTCTCAAGGCCGGG - Intronic
997998843 5:138608065-138608087 TCTTAAAGGCTGTATAGGCCAGG - Intergenic
1001275530 5:170348239-170348261 TTTTACAGGCTGAACAGGGGAGG - Intergenic
1002039844 5:176504865-176504887 TTTTAAAAGTTAACCAGGCATGG + Intronic
1002548529 5:179969570-179969592 TTTTAAAAGTGGACCATGCCAGG + Intronic
1003699544 6:8446729-8446751 TCATAAAGGCTGAACAGGCAGGG - Intergenic
1004866931 6:19862501-19862523 TTTTAAAAGCTTTGCAGGCCAGG + Intergenic
1004919092 6:20359283-20359305 TTTTAAAAGATGCACAGGCCAGG - Intergenic
1005513882 6:26536509-26536531 TTTAAAATGCTCACCAGGCATGG + Intergenic
1005849238 6:29807013-29807035 TTGAAATGGCTGACCAGGCACGG - Intergenic
1005942267 6:30569381-30569403 TTTAAAAGGATGACCTGGGCTGG - Intergenic
1006023987 6:31135510-31135532 TTTTAAAAACTGACATGGCCAGG - Intronic
1006758090 6:36435260-36435282 TTTTAAAAATTAACCAGGCCAGG + Intronic
1006968201 6:38011466-38011488 TTTTAAAGACTGACAACACCAGG - Intronic
1008054042 6:46928249-46928271 TTCTATGGGTTGACCAGGCCAGG - Intronic
1008807145 6:55443240-55443262 CTTGAAATGCTGACCAGTCCTGG - Intronic
1008981772 6:57491851-57491873 ATTTAAAAGCTGACGAGGCTGGG + Intronic
1009320192 6:62278797-62278819 TATTAAAGGCAGACACGGCCAGG + Intronic
1009589558 6:65648852-65648874 TTTTAAAAAGTGTCCAGGCCTGG + Intronic
1009698089 6:67135496-67135518 TTGTAATGGTTGGCCAGGCCCGG - Intergenic
1010541214 6:77094466-77094488 TTTTCAAGGCTTCCCAGGCTGGG + Intergenic
1011655756 6:89550658-89550680 TTTTAAAGAATGAGTAGGCCAGG + Intronic
1013481025 6:110552859-110552881 TTTTAAAGAATATCCAGGCCAGG - Intergenic
1013515801 6:110884700-110884722 TTTTAAAGGCTGTTGTGGCCAGG - Intronic
1013812460 6:114060305-114060327 TTTTAAAAGCTGTCTAGGCCAGG - Intronic
1015251674 6:131134265-131134287 TTTTAAAGCTTTACCAGGCCGGG - Intergenic
1015968463 6:138719598-138719620 TTTTAAAGGCTGGGCAGGCTGGG + Intergenic
1016183643 6:141176096-141176118 TTATAAAGGCAGCACAGGCCGGG - Intergenic
1016944989 6:149522904-149522926 TTTAAAAGGTTGTCCTGGCCAGG - Intronic
1018621072 6:165730454-165730476 TTTTAAAAGATGACAAGGCCGGG + Intronic
1020178231 7:5899460-5899482 TGTTAAAGACTGTCCAGGCTGGG + Intronic
1020304698 7:6825543-6825565 TGTTAAAGACTGTCCAGGCTGGG - Intronic
1020892862 7:13901298-13901320 TTTAAAATGCAAACCAGGCCAGG - Intronic
1021253831 7:18364675-18364697 TTTTAAAGCTTGAGAAGGCCTGG + Intronic
1021632144 7:22657949-22657971 TTTTAAAGACTGCCCAGCACAGG - Intergenic
1022302658 7:29115549-29115571 TTTTAAAGGCTGCCCAGCCCTGG - Intronic
1022766067 7:33413724-33413746 AATTAAAGCCAGACCAGGCCGGG + Intronic
1023048711 7:36233439-36233461 ATTTATTTGCTGACCAGGCCTGG - Intronic
1023979731 7:45061778-45061800 TTTAAAAGTATAACCAGGCCAGG - Intronic
1026216671 7:68355613-68355635 TTTAAATGGTAGACCAGGCCGGG - Intergenic
1026414846 7:70168610-70168632 CTTTAAAAGCAGAGCAGGCCAGG - Intronic
1026459968 7:70605361-70605383 GTTCACAGGCTGACCAAGCCAGG + Intronic
1026729338 7:72897723-72897745 TTTTGAAAGCAGACCTGGCCAGG + Intronic
1026829500 7:73602373-73602395 TTTAAAAGGGGGACCAGGCCAGG + Intronic
1028583133 7:92426978-92427000 TTTTAAAAGCTAAGAAGGCCGGG - Intergenic
1028607360 7:92669779-92669801 TTTTAAAGACTGCCCATCCCTGG + Intronic
1029080633 7:97971535-97971557 TTTTAAAGACTGTCCAGGCTGGG - Intergenic
1030115699 7:106060682-106060704 TCTTAAAGGCTAACCAGGAAAGG - Intergenic
1034198282 7:149264569-149264591 TTTTAAAAGATTACCAGGCCGGG + Intronic
1034453656 7:151151931-151151953 TTTAAAAGGATGACCAGGGGAGG - Intronic
1036010520 8:4716636-4716658 TCTTAAATGCTGAATAGGCCAGG - Intronic
1038704277 8:29879420-29879442 TCTTAAAAGTTGACTAGGCCAGG + Intergenic
1038803088 8:30767152-30767174 TTTAAAAGTCTGCTCAGGCCGGG + Intergenic
1039408782 8:37334717-37334739 TCTTAAAGGGTGGCCAGGACAGG + Intergenic
1041288572 8:56285548-56285570 GTTTACAGGCTGACCAGGGATGG - Intergenic
1042565544 8:70106389-70106411 TTTTAAAAACTCTCCAGGCCAGG + Intergenic
1042573377 8:70191743-70191765 TTCTAAAGACTGAAAAGGCCAGG + Intronic
1042823655 8:72958564-72958586 TTTTAAAAGCTGACAAGGCTGGG + Intergenic
1044424140 8:92031779-92031801 ATTTAAAGCATGACAAGGCCGGG + Intronic
1044529269 8:93289612-93289634 TTTTAAAGGCTGATGAGTGCAGG - Intergenic
1046141371 8:110097168-110097190 AATTAAAGGGAGACCAGGCCTGG - Intergenic
1047266406 8:123313736-123313758 TATTAAAAGCAGACAAGGCCAGG + Intergenic
1047395301 8:124492263-124492285 CTATAAAGGCTGGCCAGGCATGG - Intronic
1049511499 8:143029011-143029033 TTTAAATTGCGGACCAGGCCGGG - Intergenic
1050136838 9:2474330-2474352 TTTTAAATGTTGTCCAGCCCAGG - Intergenic
1050550117 9:6741861-6741883 TTTAAAATGCTTAACAGGCCAGG - Intronic
1053011159 9:34634443-34634465 TTTAAAAAGCTAACCAGGCATGG + Intergenic
1053020001 9:34688163-34688185 TTTCAAGGCCTGCCCAGGCCTGG + Intergenic
1053423694 9:37997397-37997419 TCTTAAAAGATGAGCAGGCCAGG - Intronic
1053581930 9:39414226-39414248 TTTTAAAAGCTGTCATGGCCGGG + Intergenic
1053846348 9:42241563-42241585 TTTTAAAAGCAGTCAAGGCCGGG + Intergenic
1054103508 9:60972958-60972980 TTTTAAAAGCTGTCATGGCCAGG + Intergenic
1054582844 9:66933878-66933900 TTTTAAAAGCTGTCATGGCCGGG - Intergenic
1055674311 9:78639823-78639845 TTTTAAAAGCTGGCCAGGTGGGG + Intergenic
1056221575 9:84455061-84455083 TTTGGAAGGCTGACCAGCCTGGG + Intergenic
1057047528 9:91897790-91897812 TTCCAAAGGCAGCCCAGGCCCGG + Intronic
1057241857 9:93418260-93418282 TTTTTAAGGCTAGCCAGGGCCGG - Intergenic
1057592533 9:96384539-96384561 TTTTAAAGACTGACAAGGGTAGG - Intergenic
1057811256 9:98258486-98258508 TTTTAAAGCCTATCGAGGCCAGG - Intergenic
1058589483 9:106547480-106547502 ATTTAAAAGTTGACTAGGCCAGG + Intergenic
1058643584 9:107110018-107110040 ATTTAAAGAATGAACAGGCCGGG - Intergenic
1058740189 9:107935189-107935211 TTGTAAAGGCTGAATAGGACAGG + Intergenic
1058855220 9:109055364-109055386 TTCTACAGGCTGACCTGGCAGGG + Intronic
1060379475 9:123153482-123153504 TTTTAAAGTGTGTCCAGGCCGGG - Intronic
1060870535 9:127036278-127036300 CTCCAATGGCTGACCAGGCCTGG - Intronic
1061539000 9:131267244-131267266 TTTTAAAAGGTGATCAGGCCAGG - Intronic
1062259936 9:135656496-135656518 TATTAAAAGCTGGCCAGGCGCGG + Intergenic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1186113752 X:6283270-6283292 TTTTAAAGTCTGTCCAGCACAGG + Intergenic
1186226055 X:7400227-7400249 CTTTAAAGGAAGACCTGGCCAGG - Intergenic
1189533598 X:41912601-41912623 TTTTAAAAACTGTCCAGGCCGGG - Intronic
1189847438 X:45150175-45150197 CTTTAAAGTCAGAACAGGCCAGG - Exonic
1193126953 X:77880132-77880154 GCTTAAAGGCAGACCAGGCTGGG - Intronic
1194476031 X:94360971-94360993 TTTTTAAGGCTGATGAGGCTGGG + Intergenic
1197945177 X:131830902-131830924 TGTTAGAGGCTGAGCAGGCTCGG - Intergenic
1198322727 X:135534962-135534984 TTTTAAAGGATAGCCAGGCTGGG - Intronic
1198394583 X:136208804-136208826 TTGCAAAGGCTAACCTGGCCTGG - Intronic
1201640426 Y:16171332-16171354 TTTTCCAGGGTGACAAGGCCTGG + Intergenic
1201662388 Y:16413993-16414015 TTTTCCAGGGTGACAAGGCCTGG - Intergenic