ID: 916551344

View in Genome Browser
Species Human (GRCh38)
Location 1:165852731-165852753
Sequence CTTATATAAGTTCTTTCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 334}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916551336_916551344 27 Left 916551336 1:165852681-165852703 CCCATAGAACACATCCCTTAACC 0: 1
1: 0
2: 2
3: 10
4: 111
Right 916551344 1:165852731-165852753 CTTATATAAGTTCTTTCTTCTGG 0: 1
1: 0
2: 0
3: 31
4: 334
916551341_916551344 2 Left 916551341 1:165852706-165852728 CCTCTTAGCATTTCATCTATCCT 0: 1
1: 0
2: 3
3: 24
4: 264
Right 916551344 1:165852731-165852753 CTTATATAAGTTCTTTCTTCTGG 0: 1
1: 0
2: 0
3: 31
4: 334
916551339_916551344 12 Left 916551339 1:165852696-165852718 CCTTAACCTGCCTCTTAGCATTT 0: 1
1: 0
2: 1
3: 24
4: 219
Right 916551344 1:165852731-165852753 CTTATATAAGTTCTTTCTTCTGG 0: 1
1: 0
2: 0
3: 31
4: 334
916551340_916551344 6 Left 916551340 1:165852702-165852724 CCTGCCTCTTAGCATTTCATCTA 0: 1
1: 0
2: 0
3: 15
4: 181
Right 916551344 1:165852731-165852753 CTTATATAAGTTCTTTCTTCTGG 0: 1
1: 0
2: 0
3: 31
4: 334
916551338_916551344 13 Left 916551338 1:165852695-165852717 CCCTTAACCTGCCTCTTAGCATT 0: 1
1: 0
2: 0
3: 39
4: 890
Right 916551344 1:165852731-165852753 CTTATATAAGTTCTTTCTTCTGG 0: 1
1: 0
2: 0
3: 31
4: 334
916551337_916551344 26 Left 916551337 1:165852682-165852704 CCATAGAACACATCCCTTAACCT 0: 1
1: 0
2: 1
3: 6
4: 135
Right 916551344 1:165852731-165852753 CTTATATAAGTTCTTTCTTCTGG 0: 1
1: 0
2: 0
3: 31
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916551344 Original CRISPR CTTATATAAGTTCTTTCTTC TGG Intronic
901364400 1:8733493-8733515 CTTATATGAATCCTTTCTTCTGG + Intronic
905216843 1:36414740-36414762 TTTTTATTACTTCTTTCTTCTGG + Intergenic
906099710 1:43251464-43251486 TTTATCTGAGTTCGTTCTTCAGG - Intronic
907977589 1:59447307-59447329 CTTATATCTTTTCTTTTTTCTGG + Intronic
908476164 1:64490785-64490807 TTTATATAAATTCTTGCTTTTGG - Intronic
908689225 1:66758685-66758707 TTTAGATAAGTTCATTTTTCAGG + Intronic
910093281 1:83491120-83491142 CTTGACTAAATTCTTTCTTCAGG - Intergenic
911772082 1:101757507-101757529 CTTATTACAGCTCTTTCTTCTGG - Intergenic
912678480 1:111709899-111709921 TTCATTTAAGTTCTTTCTTTGGG + Intronic
915496052 1:156283281-156283303 CTTGTACAAGTCATTTCTTCCGG - Intronic
916551344 1:165852731-165852753 CTTATATAAGTTCTTTCTTCTGG + Intronic
917196236 1:172468927-172468949 GTTATTTCAGCTCTTTCTTCAGG + Intergenic
917196265 1:172469221-172469243 GTTATTTCAGCTCTTTCTTCAGG + Intergenic
917509118 1:175655712-175655734 CTTATATAAGTGGGTTGTTCTGG + Intronic
918250748 1:182700862-182700884 CTTAAATAATTACTTTTTTCTGG - Intergenic
918328176 1:183430342-183430364 TTTTTATAACTCCTTTCTTCTGG + Intergenic
918851691 1:189698822-189698844 CTTACATACTGTCTTTCTTCAGG + Intergenic
918983955 1:191598441-191598463 TTTATATACTTTCTGTCTTCTGG - Intergenic
919413927 1:197282879-197282901 CTTATATAAGTCCCCTCTCCTGG + Intronic
919580121 1:199361223-199361245 ATAATATATGTTCTTTCTTCTGG + Intergenic
921870948 1:220139447-220139469 CTTAAATAATTTCTGTTTTCTGG + Intronic
923923364 1:238595284-238595306 ATTATATAATTTGTTTCTTATGG + Intergenic
1065076654 10:22086549-22086571 ATTATACAAGTTCTCTCTTGTGG - Intergenic
1065301749 10:24328429-24328451 CTTATCTGAGTTCTTTTCTCAGG - Intronic
1067869731 10:49946969-49946991 ATTGTATAAGGTCTGTCTTCTGG - Intronic
1068287999 10:54964160-54964182 CTTATCTAAGTTCTTTTCTTAGG - Intronic
1068342071 10:55717848-55717870 ATTATATATAATCTTTCTTCAGG - Intergenic
1068411558 10:56661840-56661862 TTTTCGTAAGTTCTTTCTTCTGG - Intergenic
1068450508 10:57180377-57180399 ATTATAGGAGTTCTTTATTCTGG + Intergenic
1069567017 10:69470375-69470397 CTTTTAAAAGTTCTTTCACCAGG - Intronic
1070678282 10:78430576-78430598 CTCATATCAATTCCTTCTTCAGG + Intergenic
1072737833 10:97891038-97891060 TGTATATAAGTTCCTTCTACTGG + Intronic
1072779626 10:98238740-98238762 TTTATGTAAGTTTTTTTTTCTGG - Intronic
1073816899 10:107217370-107217392 CATAAATAAGTTTTTTCTTTGGG - Intergenic
1074245186 10:111682987-111683009 CTAATATAAGTACTTCCTCCAGG + Intergenic
1074551710 10:114449296-114449318 CTTAAATAACTTTTTTCTTCTGG + Intronic
1074963322 10:118467219-118467241 CTTATTTGATTTGTTTCTTCAGG - Intergenic
1078516458 11:12026861-12026883 CTTATCTGAGTTCTTTTCTCAGG - Intergenic
1079467957 11:20750290-20750312 CTTGTAGGAGTTCTTTATTCTGG + Intronic
1079593743 11:22214589-22214611 AGTATATGAGTTCTTCCTTCTGG - Intronic
1079652491 11:22947198-22947220 CTCATAAAGGATCTTTCTTCAGG + Intergenic
1079766667 11:24402379-24402401 CTTATAAAATGTTTTTCTTCTGG - Intergenic
1080852947 11:36086872-36086894 CTTATAGAAGTTCCTGCTCCAGG - Intronic
1080995909 11:37601493-37601515 CTTATTTACATTCTTTCTTTTGG + Intergenic
1082721328 11:56680354-56680376 CTTATTTAACTTGTTTGTTCAGG - Intergenic
1084141339 11:67232234-67232256 CTTATATAAATATTTTCTTTGGG - Intronic
1084976706 11:72804381-72804403 TTTGTAGAAGTTCTATCTTCTGG + Intergenic
1085916898 11:80901104-80901126 CTTATAAATTTTTTTTCTTCTGG + Intergenic
1085973392 11:81622096-81622118 CTTCTCTAAATTCATTCTTCTGG + Intergenic
1087464235 11:98485091-98485113 CTTATCTGAGTTCCTTTTTCAGG - Intergenic
1088109456 11:106245575-106245597 CTTATCTGAGTTTTTTCCTCAGG - Intergenic
1089446372 11:118555968-118555990 CTTCTATAATTTTTTTTTTCTGG - Intronic
1090863525 11:130675214-130675236 CTGTTTTAAGTTCATTCTTCTGG + Intronic
1092588504 12:9925719-9925741 CTTATTTGAGTTCATTCTTTAGG + Intronic
1093840642 12:23895442-23895464 CTAATAAAAGTTTTTTTTTCTGG - Intronic
1094434147 12:30402604-30402626 CTTATCTGAGTTCTTTTCTCAGG + Intergenic
1095100778 12:38181225-38181247 CTTCTAAAAGTTCCTTCTGCTGG - Intergenic
1097484769 12:60182303-60182325 CTTATATAAATTAGTCCTTCTGG - Intergenic
1097609418 12:61800308-61800330 CAAATATAAATTCTTCCTTCAGG - Intronic
1099565840 12:84245235-84245257 TATATATAAGTTCCTTCTTTTGG - Intergenic
1100130122 12:91482149-91482171 CTTATATAACTCTTTTCTTTTGG - Intergenic
1100234254 12:92643001-92643023 TTTATCTGAGTTCCTTCTTCAGG + Intergenic
1100552512 12:95658932-95658954 CTTATCTAACTTATCTCTTCTGG - Exonic
1100709336 12:97238219-97238241 GTTATATTAGTTCTTGCTTTTGG + Intergenic
1102037046 12:109776716-109776738 CTTATATAAATGCTTTCACCAGG + Intergenic
1102912941 12:116732236-116732258 TTTATATAAATCCTTTCTTCTGG - Intronic
1104379624 12:128295680-128295702 CTTATTTTTCTTCTTTCTTCAGG - Intronic
1104522216 12:129486333-129486355 CTTGTCTCAGGTCTTTCTTCTGG + Intronic
1104764771 12:131321200-131321222 CTTATAGAAGTTATATCTTATGG - Intergenic
1105451068 13:20500875-20500897 TTTATCTGAGTTCTTTCCTCAGG + Intronic
1107509230 13:41065786-41065808 GTTAAATAAGGTCTTTCATCTGG - Intronic
1108383193 13:49874040-49874062 TTTATCTGAGTTCCTTCTTCAGG + Intergenic
1108685044 13:52812165-52812187 CAAATTTAATTTCTTTCTTCAGG - Intergenic
1109075171 13:57824682-57824704 CTTATATAACTCCTTTCTCTTGG + Intergenic
1109292061 13:60488347-60488369 TTTATCTGAGTTCTTTCCTCAGG - Intronic
1109571505 13:64197631-64197653 TTTTTATCAGTTTTTTCTTCTGG + Intergenic
1110104753 13:71658184-71658206 ATTATATAAATTCATTCTTAGGG + Intronic
1110313571 13:74079147-74079169 CTCATATAAGTGATTTCTTCTGG - Intronic
1110520724 13:76473013-76473035 CTTATCTGAGTTCCTTCCTCAGG + Intergenic
1110537400 13:76667409-76667431 TTTATCTGAGTTCCTTCTTCAGG - Intergenic
1111197098 13:84889066-84889088 TTTATCTGAGTTCTTTCATCAGG - Intergenic
1111215596 13:85136557-85136579 CATATATATGTTTTTTCTACAGG - Intergenic
1111220410 13:85197664-85197686 CTTATCTGAGTTCCTTCCTCAGG - Intergenic
1111557934 13:89905934-89905956 TTTATCTGAGTTCTTTCCTCTGG + Intergenic
1111779787 13:92707787-92707809 CTTATATGAGATCTTGCCTCTGG - Intronic
1111804540 13:93023329-93023351 CTTAAATAAAGTCTTTCTACCGG - Intergenic
1111880639 13:93952199-93952221 TTTCAATAAGTTCTATCTTCTGG - Intronic
1112378252 13:98864116-98864138 ATTAAATAAGTTCTTCATTCAGG - Intronic
1113601748 13:111574260-111574282 CTTATCTGAGTTCCTTTTTCAGG - Intergenic
1115286013 14:31713093-31713115 CTTATTTAAGTTCCTTTCTCAGG - Intronic
1115901595 14:38157001-38157023 CTTAGTTAAGTTCTTTGCTCCGG - Intergenic
1116071295 14:40048860-40048882 CTTTTTAAATTTCTTTCTTCTGG - Intergenic
1116380389 14:44260838-44260860 CTTATCTGAGTTCCTTCCTCAGG + Intergenic
1116881427 14:50173358-50173380 CTTTTTTAAGTTCTTTTTTATGG + Intronic
1116934029 14:50719099-50719121 CTTCTATCAGTTCCTACTTCTGG - Intergenic
1119024152 14:71139421-71139443 CACATGTAAGTTCTTTCTCCTGG + Intergenic
1120424015 14:84324135-84324157 CTTTTCTAAGCTCTTTGTTCTGG + Intergenic
1202868712 14_GL000225v1_random:139586-139608 CTTTTATAAGCTCTGTCTACAGG + Intergenic
1124422755 15:29537052-29537074 CTAATACACCTTCTTTCTTCTGG + Intronic
1125123585 15:36194102-36194124 CTTGTCTAAGTTCTTATTTCTGG - Intergenic
1125878351 15:43169184-43169206 CTTATGAAAGTGCTTTCTTGTGG + Intronic
1126707985 15:51424652-51424674 CTTATGGAAGTTGTTTCTTATGG - Intergenic
1127210950 15:56773993-56774015 TTTCTATAAGTTCTTTAGTCGGG + Intronic
1128473623 15:67977712-67977734 GTTTTATTAGTTCCTTCTTCAGG - Intergenic
1128488692 15:68123785-68123807 CTTGTATAATTTCTGTCTTCAGG + Intronic
1131563723 15:93466498-93466520 CTTATCTAGGTTCCTTTTTCAGG - Intergenic
1132017928 15:98335573-98335595 CTTATCTAAGTTCCTTTTTCAGG + Intergenic
1134599303 16:15520856-15520878 CTTATCTGAGTTATTTCCTCAGG + Intronic
1135947134 16:26875133-26875155 CTTATCTGAGTTCCTTCATCAGG + Intergenic
1137894258 16:52194122-52194144 GTTAAATAGTTTCTTTCTTCTGG - Intergenic
1138700427 16:58856954-58856976 CTTACATCATTTCTGTCTTCTGG - Intergenic
1141358607 16:83373453-83373475 CGTACATAGGTTCCTTCTTCCGG - Intronic
1142205437 16:88780632-88780654 TTTATATAAGCTTTTTCTTCTGG - Intronic
1147469061 17:40640176-40640198 CTTATTTAAGAGCTTTCTTCTGG + Intronic
1149077258 17:52610567-52610589 TTTAAATAAGTTATTTCTTGAGG + Intergenic
1150569960 17:66376795-66376817 CCCATGTAAGTCCTTTCTTCAGG + Intronic
1152173082 17:78766698-78766720 TTTCTAAACGTTCTTTCTTCTGG - Intronic
1153041935 18:820886-820908 CTTAAAGAAGTTGTTTATTCTGG - Intergenic
1153712595 18:7814944-7814966 CTTATCTGAGTTCCTTTTTCAGG + Intronic
1153712601 18:7815018-7815040 CTTATCTGAGTTCCTTTTTCAGG + Intronic
1155078217 18:22381718-22381740 TTTATATAAGTTGTTTCTCTTGG - Intergenic
1155585358 18:27357910-27357932 CTGATATAAGTTGTATTTTCTGG + Intergenic
1156240125 18:35245543-35245565 CATCTATAAGGTCTCTCTTCTGG - Exonic
1156551354 18:38021980-38022002 CTTATCTAATTACTTTCTTCAGG - Intergenic
1156713555 18:39977594-39977616 GGGATATAAGTTCTTACTTCGGG + Intergenic
1158899000 18:61944260-61944282 GTTGTAAAAGTTCTTTATTCTGG + Intergenic
1159183591 18:64942833-64942855 CTTCTCTAATTTTTTTCTTCCGG + Intergenic
1159198464 18:65149827-65149849 CTTATCTAAGTTCCTTTCTCAGG - Intergenic
1159969202 18:74628102-74628124 CTTATATAATTTATATTTTCTGG + Intronic
1160074557 18:75660112-75660134 CTTTCATAAGTACATTCTTCTGG + Intergenic
1163081327 19:14944985-14945007 CTGACATAAATTCTTACTTCTGG + Intergenic
1163232151 19:16011906-16011928 CTTATATAAATTATATCTTATGG + Intergenic
925310586 2:2878869-2878891 CGGATATAAGTTCTTACTTTGGG + Intergenic
927367658 2:22317942-22317964 TTTATGTAAGTGCTTTCTTAAGG + Intergenic
928346358 2:30500871-30500893 CTTATCTGAGTTCCTTTTTCAGG + Intronic
928751498 2:34475776-34475798 CATATAGAATTTCTTTCTTTAGG + Intergenic
928911989 2:36430932-36430954 CTTATATAGGTAATTTCTCCTGG - Intronic
928942268 2:36738414-36738436 CTAATATAGGTTCTTTCATTTGG - Intronic
929307622 2:40381717-40381739 CTTATCTGAGTTCCTTTTTCAGG + Intronic
930086293 2:47499761-47499783 CTTATCTGAGTTCCTTCCTCAGG + Intronic
930145474 2:47998487-47998509 CTTATATATTTGCTTACTTCTGG + Intergenic
930450628 2:51532535-51532557 CTTCTATCAGTTGTTGCTTCAGG + Intergenic
931047602 2:58373729-58373751 CTTATCTGAGTTCCTTCCTCAGG - Intergenic
931068674 2:58619181-58619203 CTTATACAAGTTTTTTATTGTGG - Intergenic
931181178 2:59902122-59902144 CTAAGATAAGTTTTTACTTCAGG - Intergenic
932965981 2:76475039-76475061 CTTATATAAAATCTCTTTTCTGG - Intergenic
933192583 2:79352206-79352228 CTTGTATAATTTTTTTTTTCTGG + Intronic
933359499 2:81261565-81261587 CTTAAGACAGTTCTTTCTTCTGG + Intergenic
934137293 2:89008907-89008929 CTTATCTGAGTTCCTTTTTCAGG + Intergenic
934233806 2:90211582-90211604 CTTATCTGAGTTCTTTTTTCAGG - Intergenic
935271765 2:101440908-101440930 CTTATATAAGGTCCTTGTTATGG + Intronic
935587350 2:104813654-104813676 CTTATATAATTTATTTTTTTCGG + Intergenic
936253286 2:110885811-110885833 GTTATATAAGCTATTTCTTTTGG + Intronic
937005709 2:118511028-118511050 CTTTTATAATTGATTTCTTCTGG + Intergenic
937163671 2:119792241-119792263 CTTATATAAATTATTTTTTAGGG + Intronic
938175864 2:129128222-129128244 TTTATCTGAGTTCTTTCCTCAGG + Intergenic
939353782 2:141074639-141074661 CATATATAATTTTTTTCATCTGG + Intronic
939881680 2:147638815-147638837 CTTATGTAACGTCTTTCTTCTGG + Intergenic
940521707 2:154758906-154758928 CTTTTTTAAGCTTTTTCTTCAGG + Intronic
941046487 2:160681663-160681685 GTTGGATAAGTTCTTTATTCTGG + Intergenic
941435079 2:165460160-165460182 CTTTTATCAGTTATTTTTTCTGG + Intergenic
941895134 2:170621373-170621395 CTAATATAACACCTTTCTTCAGG + Intronic
942386759 2:175451013-175451035 TTTATCTGAGTTCTTTCCTCAGG + Intergenic
943449684 2:188032580-188032602 CTCCTATAAGTTCCTTCATCTGG + Intergenic
944742275 2:202624212-202624234 TTTACATTAGATCTTTCTTCAGG + Intergenic
946033335 2:216722664-216722686 CTTTTTAAAGTTCTTTCTTAAGG - Intergenic
947023158 2:225706030-225706052 CTTATAATAGTTATTTCTTTGGG + Intergenic
948007222 2:234619625-234619647 TTCATTTAAGTTTTTTCTTCTGG - Intergenic
948337955 2:237225546-237225568 TTTAAATAAGTTTTTTATTCTGG + Intergenic
1169527301 20:6443284-6443306 CTTCTAAAAGTTCCTTCTGCTGG + Intergenic
1169582226 20:7036493-7036515 CTTACAAAACTTCTTTATTCAGG + Intergenic
1169664208 20:8016721-8016743 CTTATATGCGCTCTTTCATCTGG - Intronic
1170463820 20:16604629-16604651 CTAATATATGTTATTTTTTCAGG + Intergenic
1171254314 20:23676273-23676295 CATCTATTATTTCTTTCTTCAGG + Intergenic
1175032908 20:55973294-55973316 CTAATAACAGTTCTTTCTTGAGG - Intergenic
1178993039 21:37370608-37370630 TTTAGATAAGTTTTTTCTTGGGG - Intronic
1183008475 22:34924728-34924750 CTTTTAAAAGGTTTTTCTTCAGG + Intergenic
1183760776 22:39815005-39815027 TTTATAGGAGTTCTTTATTCTGG - Intronic
1183761749 22:39826495-39826517 ATAATCTAAGTTCTTTCCTCAGG - Intronic
1184180665 22:42822403-42822425 CTTATATATGTTCTAGCTTGGGG - Exonic
1185362339 22:50415837-50415859 CGTATGTAAGCTCTGTCTTCAGG - Intronic
949407796 3:3733107-3733129 TTTACATAAGTTCTGTCTTGGGG - Intronic
949433707 3:4005632-4005654 CTTATTTCAGTTCTTTCTTTTGG - Intronic
949711840 3:6879983-6880005 CTTTTAAATGTTCTTTCTTCTGG - Intronic
949718194 3:6957836-6957858 TTTATATAATGTCTTTCCTCTGG - Intronic
950505841 3:13393982-13394004 CTGAAATCAGTTCATTCTTCTGG - Intronic
952546302 3:34423394-34423416 TTTATTTAATTTCTTGCTTCAGG + Intergenic
952805652 3:37348842-37348864 CTTATGCTAGGTCTTTCTTCAGG - Intronic
953595628 3:44310164-44310186 CTTATATAATTTCTTCTTTAAGG - Intronic
954381593 3:50221786-50221808 CTTGAGGAAGTTCTTTCTTCAGG - Intergenic
955610238 3:60749230-60749252 CTTTCATAAATTCCTTCTTCAGG - Intronic
957225395 3:77437868-77437890 CTGATATAAGTTCTTGCATCTGG - Intronic
958120845 3:89286052-89286074 CTTATCTGAGTTCCTTCCTCAGG - Intronic
958448929 3:94249373-94249395 CTTCTAAAAGTTCTGTCCTCTGG - Intergenic
959441830 3:106386151-106386173 CTTATCTAAGTTCCTTTCTCAGG + Intergenic
959457143 3:106576735-106576757 CTTACCTGAGTTCTTTCCTCAGG + Intergenic
959504406 3:107141936-107141958 CTTATCTGAGTTCCTTCTTGAGG - Intergenic
964085695 3:152815526-152815548 ATGTTTTAAGTTCTTTCTTCAGG + Intergenic
964137683 3:153363572-153363594 CTTATCTGAGTTCCTTTTTCAGG - Intergenic
965315517 3:167184851-167184873 CTTATATAAATTCTTTATTTTGG - Intergenic
967370299 3:188737334-188737356 CTTATTGAGGTTCTCTCTTCTGG + Intronic
967863629 3:194172484-194172506 CTTAGATGAATTCTTTCCTCCGG - Intergenic
970402858 4:15734719-15734741 CTTATCTGAATTCCTTCTTCAGG - Intronic
972007345 4:34127568-34127590 CTTATATATGCTCTATCTCCAGG - Intergenic
973976304 4:56266172-56266194 CATATGTAAGTTCTTTCATAAGG + Intronic
974124339 4:57677221-57677243 CTTATCTGAGTTCTTTCCTCAGG + Intergenic
974184957 4:58433084-58433106 CTCATATATCTTCTTTATTCAGG - Intergenic
974538323 4:63198093-63198115 TTTATCTAAGTTCCTTCCTCAGG + Intergenic
974566394 4:63582068-63582090 CTTATCTGAGTTCCTTCCTCGGG - Intergenic
974580221 4:63789269-63789291 GTTATTTAAGCACTTTCTTCTGG + Intergenic
975219805 4:71801100-71801122 GTTATAAGAGTTCTCTCTTCTGG - Intronic
976537477 4:86235206-86235228 CTCATAAAAGTTCTCTCTTTTGG - Intronic
976659447 4:87524455-87524477 TTTATCTAAGTTCCTTCCTCAGG + Intronic
977100778 4:92811651-92811673 CCTATATGATTTTTTTCTTCAGG + Intronic
977328516 4:95607114-95607136 CGTATTTAATCTCTTTCTTCGGG - Intergenic
977861171 4:101961934-101961956 CTTATATAAGTTCAGTCACCAGG + Intronic
978666205 4:111184894-111184916 TATAAATAAGTTTTTTCTTCTGG + Intergenic
978748203 4:112218999-112219021 TTTATCTGAGTTCTTTCCTCAGG - Intergenic
979619394 4:122781915-122781937 ATTAAACAAGTTATTTCTTCTGG + Intergenic
981216598 4:142176860-142176882 CTCATAAAAGTTCCTTCTTAAGG + Intronic
981447675 4:144858997-144859019 ATTTTATTAGTTCTTTCTTATGG + Intergenic
981591851 4:146373110-146373132 CTTTAAAATGTTCTTTCTTCAGG - Intronic
981761319 4:148198693-148198715 TTTTTTTTAGTTCTTTCTTCAGG - Intronic
981858542 4:149326082-149326104 CTTATCTGAGTTCTTTTCTCAGG + Intergenic
984147865 4:176086600-176086622 TTTACATAAGATCTTTCTTTTGG + Intronic
984239779 4:177204361-177204383 CTTATCTAAGTTCTGTTTTCAGG - Intergenic
984313145 4:178090482-178090504 GTAATAGAAGTTCTTACTTCAGG - Intergenic
985901193 5:2795526-2795548 TTTATATGTGTTATTTCTTCTGG + Intergenic
987111561 5:14692612-14692634 GTTGTAAAAGTTCTTTATTCTGG + Intronic
988045786 5:25951117-25951139 CTTATCTAAGTTCCTTCCTCAGG - Intergenic
988356894 5:30188483-30188505 CATATATAAGATTTTTTTTCAGG + Intergenic
988613759 5:32753464-32753486 CTGATACATGTTCTTTCTACAGG - Intronic
990113761 5:52362767-52362789 TTTAATTAAGTTTTTTCTTCAGG - Intergenic
990199510 5:53355471-53355493 ATTATATAACTTCCTTCTTTGGG - Intergenic
990234239 5:53750300-53750322 CTTATAAAAATGCTTTCTTAAGG - Intergenic
991204041 5:64029745-64029767 CTGTTCAAAGTTCTTTCTTCTGG + Intergenic
992035459 5:72770323-72770345 CTTATATCAGATTTTTCTTTAGG + Intergenic
992132860 5:73711485-73711507 CTTATTTTATTTCTTTCATCAGG + Intronic
992913237 5:81420012-81420034 TTTATATAAGTTATTTTTTAAGG - Exonic
994788898 5:104199381-104199403 CTGGTAGCAGTTCTTTCTTCTGG + Intergenic
994915127 5:105966067-105966089 TTTTTATAATTTTTTTCTTCTGG + Intergenic
995007163 5:107213481-107213503 CATTTATAATTTCTTTGTTCTGG - Intergenic
996133851 5:119814671-119814693 CCTAAATAAGTGCTTTCATCTGG + Intergenic
996583124 5:125053742-125053764 CTTAATTCACTTCTTTCTTCTGG + Intergenic
996655710 5:125933451-125933473 CTTATCTGAGTTCTTTCCTCAGG + Intergenic
997555181 5:134791267-134791289 CTTATATATGCTCTTTGCTCAGG + Intronic
998842430 5:146269459-146269481 ATTATATTTGCTCTTTCTTCTGG - Exonic
999051982 5:148532635-148532657 TATATATAATTTCTCTCTTCAGG - Intronic
1000540530 5:162533578-162533600 CATATATCATTTCTTTGTTCGGG + Intergenic
1001624202 5:173117075-173117097 CTTCTAAAGGTTCTTTATTCTGG + Intronic
1002807926 6:595933-595955 CCTATATACATTCTTTCTTATGG + Intronic
1004795771 6:19082507-19082529 GTTATAAGAGTTCTTTATTCTGG - Intergenic
1005048249 6:21662640-21662662 CTTATATATGTTCTTTCTAAAGG - Intergenic
1005415114 6:25592007-25592029 CTTGTATAATTTCTTCCCTCAGG - Intronic
1008149534 6:47933682-47933704 TTAATATAAGTTCTTTCTTTTGG + Intronic
1008722740 6:54376852-54376874 ATTATTTAAGCTCTTCCTTCAGG - Intronic
1010016173 6:71106995-71107017 CTTTCACAAGTTCTTTCTCCAGG - Intergenic
1010452625 6:76019858-76019880 CTAATATAAGTTCTTCTCTCTGG - Intronic
1010494406 6:76515582-76515604 CTTATCTGAGTTCTTTTCTCAGG + Intergenic
1010572460 6:77494333-77494355 CCTATTTATGTTCTTTCTTAAGG + Intergenic
1010726939 6:79345611-79345633 CTTATATAAGTCCTTACATTGGG + Intergenic
1011030584 6:82918722-82918744 CTTATCTGAGTTCCTTCCTCAGG + Intronic
1011345387 6:86364273-86364295 CTTATAACAATGCTTTCTTCTGG + Intergenic
1011929139 6:92688436-92688458 CTTATATGAGTTCCTTTCTCGGG + Intergenic
1012003045 6:93678624-93678646 TTTATATAAATTGTTTCTTGAGG - Intergenic
1013242115 6:108255798-108255820 CTTGTATATGTTTTTTCCTCTGG - Intronic
1013968017 6:115979160-115979182 ATGATAAAAGTGCTTTCTTCTGG - Intronic
1014139855 6:117928970-117928992 CTTATCTGAGTTCCTTTTTCAGG + Intronic
1014480753 6:121933809-121933831 GTTTTATCAGTTCTTTCTTGTGG + Intergenic
1015115087 6:129639215-129639237 CCTATATAAGTTTTTTTTGCTGG - Intronic
1016019560 6:139221411-139221433 CTAAAATAAGTACTCTCTTCAGG + Intergenic
1016232769 6:141826841-141826863 CTTATCTGAGTTATTTCCTCAGG - Intergenic
1018676410 6:166226206-166226228 CTTATATTAGTTTTTTGTTAGGG - Intergenic
1020815447 7:12900273-12900295 CTTACATCATGTCTTTCTTCTGG - Intergenic
1021121963 7:16806088-16806110 TTTATAGAAGTAATTTCTTCAGG + Intronic
1021261349 7:18460997-18461019 CTTATTTAATTTTCTTCTTCTGG - Intronic
1021588669 7:22237430-22237452 TTTATCTGAGTTCTTTCCTCAGG + Intronic
1023321527 7:39003384-39003406 CTAATATAATTTCTTTATCCAGG - Intronic
1023547346 7:41331929-41331951 CTTATCTAAGTTCTCTCAGCTGG - Intergenic
1024029341 7:45444578-45444600 CTTACTTAAGTGCTTTATTCTGG - Intergenic
1024601924 7:50989660-50989682 CTTATACCAGTTTTTGCTTCAGG - Intergenic
1024901668 7:54324843-54324865 CTTATATAAGATGTTACTACTGG + Intergenic
1027604103 7:80278294-80278316 CTTATAAAACTTTTATCTTCGGG + Intergenic
1027672222 7:81115897-81115919 CTTAAATAAATTCTTCCTTATGG + Intergenic
1027753755 7:82185057-82185079 GTTGTATAACTTCTTTCATCAGG - Intronic
1027815744 7:82968402-82968424 ATTATGGAAGTTCTTCCTTCAGG - Intronic
1027998380 7:85457303-85457325 CTTATTAAACTTCTTTCTTTAGG - Intergenic
1028940445 7:96516060-96516082 CGTATATAAGGCCTTTCTTTAGG - Intronic
1030314650 7:108102203-108102225 CTTATAGAAGTTTTTCCTTTAGG - Intronic
1030899157 7:115100938-115100960 CTGATAAAAGTTCTTTCCTTTGG + Intergenic
1031170547 7:118287033-118287055 CTTAAATAGGTCTTTTCTTCAGG - Intergenic
1031802652 7:126268252-126268274 CTCATTTAATTTCTTTCATCAGG - Intergenic
1033690712 7:143733983-143734005 CTATGATAAGTTATTTCTTCAGG + Intergenic
1035352220 7:158254819-158254841 TTTAAATAATTTGTTTCTTCAGG - Intronic
1036518834 8:9471715-9471737 TTTATCTGAGTTCCTTCTTCAGG + Intergenic
1036547393 8:9785081-9785103 TTTATCTTAGTTCTTTCCTCAGG - Intergenic
1037261444 8:17013875-17013897 TGAATAGAAGTTCTTTCTTCAGG - Intergenic
1037423178 8:18725808-18725830 CTTTTATAACTTGTTTCTTCGGG - Intronic
1038382903 8:27113541-27113563 CTTATCTGAGTTCCTTTTTCAGG + Intergenic
1038955324 8:32462022-32462044 CTTTTAGCATTTCTTTCTTCTGG + Intronic
1039162920 8:34642337-34642359 CTTTTCTGAGTTCCTTCTTCAGG - Intergenic
1039389712 8:37168299-37168321 CTTATCTGAGTTCATTCCTCAGG - Intergenic
1039834099 8:41242515-41242537 CTTATGTGAGTTTTGTCTTCAGG - Intergenic
1040028513 8:42803442-42803464 TTTATCTGAGTTCTTTCCTCAGG + Intergenic
1040040129 8:42907702-42907724 TATATATACTTTCTTTCTTCTGG - Intronic
1042288579 8:67142179-67142201 TTTATTAAAGTTCTTTATTCAGG + Intronic
1042607120 8:70556646-70556668 CTTTTTAAAGTTCTTTATTCTGG + Intergenic
1043120354 8:76314474-76314496 CTTAAATGAGTTCTGTCTTTAGG - Intergenic
1043552250 8:81387424-81387446 CATATATATGTTCTTTATTGTGG - Intergenic
1044067040 8:87711319-87711341 TTTAGATTAGATCTTTCTTCTGG - Intergenic
1044112530 8:88292936-88292958 TTTTCAGAAGTTCTTTCTTCAGG - Intronic
1044133426 8:88555743-88555765 GTTGTAGAAGTTCTTTATTCTGG + Intergenic
1044146011 8:88714656-88714678 CTTATAGAAGTCTTTTCTCCCGG + Intergenic
1044945026 8:97381629-97381651 CTCATCTGAGTTCTTTCCTCAGG - Intergenic
1045499789 8:102736490-102736512 CTTATCTGAGTTCTTTTCTCAGG + Intergenic
1045531450 8:102989043-102989065 CTTATCTGAGTTCTTTTTTCAGG + Intergenic
1045572402 8:103381696-103381718 GTTATAAAAGTTATTTCTTCTGG + Intronic
1045810973 8:106219698-106219720 GTTATATAAATTCTTTCCTAGGG - Intergenic
1045908154 8:107373606-107373628 CTTATCTCACTTCTTTCTTCAGG - Intronic
1046396680 8:113649299-113649321 CTTATCTGAGTTCCTTCCTCAGG - Intergenic
1046705392 8:117444256-117444278 ATTATATTAGTGCTTTGTTCAGG + Intergenic
1049878202 8:145041621-145041643 CTTATCTGAGTTCCTTCCTCAGG + Intergenic
1050009077 9:1167585-1167607 CCTTTAGAATTTCTTTCTTCTGG + Intergenic
1050851745 9:10296331-10296353 TTTATCTGAGTTCCTTCTTCAGG + Intronic
1051055900 9:12985420-12985442 ATTATATATATTTTTTCTTCTGG - Intergenic
1051692241 9:19727687-19727709 TTTTAAAAAGTTCTTTCTTCTGG - Intronic
1052485475 9:29093211-29093233 ATTATATGAGTTGTTTCTACAGG - Intergenic
1054132263 9:61380252-61380274 CATATATAATTTATTTTTTCTGG + Intergenic
1054744542 9:68841429-68841451 CATATATCATTTCCTTCTTCTGG - Intronic
1055100324 9:72457309-72457331 CTTATCTATTTTCTTTCTACTGG - Intergenic
1055614438 9:78056205-78056227 CATATTTAAGTGCTTCCTTCAGG - Intergenic
1055739574 9:79371886-79371908 CATATATTGTTTCTTTCTTCTGG + Intergenic
1056021586 9:82443554-82443576 GTCATACAAGTTCTGTCTTCAGG - Intergenic
1057467259 9:95326235-95326257 CTTATGTAAGTTATATCTTATGG - Intergenic
1058343523 9:103928069-103928091 GTTTTATAAGTTTTTTTTTCTGG - Intergenic
1059358757 9:113722519-113722541 GTTATAGGAGTTCTTTATTCTGG - Intergenic
1062211766 9:135368434-135368456 TTTATTTGAGTTCCTTCTTCAGG + Intergenic
1203736064 Un_GL000216v2:140667-140689 CTTTTATAAGCTCTGTCTACAGG - Intergenic
1187084575 X:16028700-16028722 CTTATATGAGTTCCTTCCTCAGG + Intergenic
1187803887 X:23096868-23096890 TTTTAATAATTTCTTTCTTCTGG - Intergenic
1187816479 X:23238226-23238248 CTTATATAAGTTTTTTTTCCTGG + Intergenic
1188131534 X:26439831-26439853 TTTATTTAATTGCTTTCTTCGGG + Intergenic
1189430509 X:40942620-40942642 ATTATAAAAGTTATTTATTCAGG - Intergenic
1191119292 X:56886868-56886890 CTTATCTAAGTTTCTTCCTCGGG - Intergenic
1192255742 X:69456518-69456540 ATAATATAAGTTCTTACCTCAGG - Intergenic
1192724689 X:73736732-73736754 CTCATGTGAGTTCTTTCCTCAGG + Intergenic
1193429876 X:81389113-81389135 CTTATATAGGCTGTTTCTTCAGG - Intergenic
1193577530 X:83219979-83220001 ATAATTTAACTTCTTTCTTCTGG - Intergenic
1194009293 X:88538435-88538457 TTTATCTGAGTTCCTTCTTCAGG - Intergenic
1194185293 X:90767392-90767414 CTGATATAAGTTTCTTCTTGTGG + Intergenic
1194425214 X:93728868-93728890 CATATATATTTTCTTTCATCTGG + Intergenic
1194695090 X:97037701-97037723 TTTTTATAAGTACTTTATTCTGG + Intronic
1195472486 X:105246693-105246715 CTTATCTGAGTTCTTTTCTCAGG - Intronic
1195481335 X:105348920-105348942 CTTATCTGAGTTCCTTCCTCAGG - Intronic
1196294063 X:113978822-113978844 TTTATCTAAGTTCCTTCCTCAGG + Intergenic
1196360998 X:114858013-114858035 CTTATATATGTTGTTTCTCCTGG + Intronic
1196665149 X:118308176-118308198 TTTATCTAAGTTCTTTCCTCAGG - Intergenic
1198386271 X:136132261-136132283 TTTATCTGAGTTCTTTCCTCAGG - Intergenic
1200531919 Y:4349479-4349501 CTGATATAAGTTTCTTCTTGTGG + Intergenic
1202249188 Y:22852357-22852379 TTTATATAAGATCAGTCTTCAGG + Intergenic
1202273576 Y:23093929-23093951 CTGAAATATGTTCTTTGTTCAGG - Intergenic
1202292450 Y:23326753-23326775 CTGAAATATGTTCTTTGTTCAGG + Intergenic
1202402174 Y:24486105-24486127 TTTATATAAGATCAGTCTTCAGG + Intergenic
1202426573 Y:24727673-24727695 CTGAAATATGTTCTTTGTTCAGG - Intergenic
1202444216 Y:24942413-24942435 CTGAAATATGTTCTTTGTTCAGG + Intergenic
1202468606 Y:25183979-25184001 TTTATATAAGATCAGTCTTCAGG - Intergenic