ID: 916551625

View in Genome Browser
Species Human (GRCh38)
Location 1:165855331-165855353
Sequence AGCAAAGATGTCCCCAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916551622_916551625 16 Left 916551622 1:165855292-165855314 CCTATTCCTAGTTCTTGTCTGAA 0: 1
1: 2
2: 2
3: 13
4: 245
Right 916551625 1:165855331-165855353 AGCAAAGATGTCCCCAAATAAGG 0: 1
1: 0
2: 1
3: 27
4: 173
916551621_916551625 25 Left 916551621 1:165855283-165855305 CCACAAACACCTATTCCTAGTTC 0: 1
1: 0
2: 0
3: 11
4: 172
Right 916551625 1:165855331-165855353 AGCAAAGATGTCCCCAAATAAGG 0: 1
1: 0
2: 1
3: 27
4: 173
916551624_916551625 -10 Left 916551624 1:165855318-165855340 CCATTTATTTTGCAGCAAAGATG 0: 1
1: 0
2: 1
3: 26
4: 365
Right 916551625 1:165855331-165855353 AGCAAAGATGTCCCCAAATAAGG 0: 1
1: 0
2: 1
3: 27
4: 173
916551623_916551625 10 Left 916551623 1:165855298-165855320 CCTAGTTCTTGTCTGAATCTCCA 0: 1
1: 0
2: 1
3: 16
4: 191
Right 916551625 1:165855331-165855353 AGCAAAGATGTCCCCAAATAAGG 0: 1
1: 0
2: 1
3: 27
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916551625 Original CRISPR AGCAAAGATGTCCCCAAATA AGG Intronic
907777451 1:57531837-57531859 AACAAGGATGTCACTAAATATGG + Intronic
909798767 1:79779011-79779033 AGGGAATATGTCCCCAGATATGG - Intergenic
911963792 1:104339871-104339893 AGCTAAGATTCCCCCAAAAAAGG - Intergenic
913369241 1:118079207-118079229 ATCAAAAATCTTCCCAAATAGGG - Intronic
915554617 1:156654516-156654538 AGAATAGTTGTCCCCAAAAAGGG + Intronic
916551625 1:165855331-165855353 AGCAAAGATGTCCCCAAATAAGG + Intronic
916960842 1:169887299-169887321 AGCACAGAAGTCCTCAAAAATGG + Intronic
917951423 1:180040717-180040739 AAAAATGATGTCCCCATATAAGG - Intronic
922817821 1:228463577-228463599 AGCTAAAATTTCCCCAATTAAGG - Intergenic
1063184743 10:3640724-3640746 AACAAAGATGTCCTCTAATTTGG + Intergenic
1063268439 10:4479759-4479781 AGGAAATATGGACCCAAATATGG - Intergenic
1064426730 10:15236120-15236142 AACAATGATGTTTCCAAATATGG + Intronic
1064507279 10:16046691-16046713 ATCAAAGATGTACACAAATAGGG - Intergenic
1066186769 10:33016976-33016998 AAAACAGATGTCCCCAAAGAGGG - Intergenic
1068077196 10:52270958-52270980 AGTAAAGATGGCCAAAAATAGGG - Intronic
1068942541 10:62693753-62693775 AGCAAACTTGTCACCAAATCAGG + Intergenic
1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG + Intergenic
1070549053 10:77476284-77476306 AACAAAGATGGCCCCAGAAAGGG + Intronic
1070721815 10:78762143-78762165 GGGAAAGCTGTCTCCAAATAGGG + Intergenic
1071172459 10:82882563-82882585 AGCAATAATGTCACCAAATAAGG + Intronic
1071281434 10:84107736-84107758 AACAATTATGTCCCCAAAGAGGG + Intergenic
1072218374 10:93307256-93307278 AGCAAAAATCTCCCCTAATTGGG + Intronic
1075792428 10:125094612-125094634 ACCAGAGATGTCGCCAGATAGGG - Intronic
1078504186 11:11918145-11918167 AGCAAAGATGTGCCCTTCTAAGG - Intronic
1081643948 11:44777169-44777191 AGCACAAAAGTTCCCAAATAGGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084197717 11:67533797-67533819 AGCAAACATGTGGCCAAAAAAGG - Intergenic
1087092496 11:94288248-94288270 AGGATAGATGTCACCAAAAATGG + Intergenic
1087628026 11:100619359-100619381 AGGAAAGCTGCCCCAAAATATGG - Intergenic
1090665598 11:128913149-128913171 AGCAAAGGTCTCTCCAAGTAAGG - Intronic
1091067807 11:132532964-132532986 AACAAAGATCTGCCAAAATACGG - Intronic
1091072082 11:132576643-132576665 GGCAAAGATGTCCCAAATAAAGG - Intronic
1092842522 12:12556780-12556802 AGCAAAGATGTTCCAAAATGGGG - Intronic
1096428888 12:51527051-51527073 AGCACAGATGTCCAACAATAGGG - Intergenic
1098624432 12:72645102-72645124 AGGAAAGATGTCCCAAACAAAGG + Intronic
1098708019 12:73715964-73715986 AACAAAGATGTCCCCAAACAAGG - Intergenic
1099322895 12:81173673-81173695 CTCAACAATGTCCCCAAATAGGG - Intronic
1104927736 12:132322309-132322331 AGCAGAGATGTCCCCACCTCAGG - Intronic
1107598971 13:41993180-41993202 ATCAAAGATGTCGCCTAAGATGG + Intergenic
1112195728 13:97224323-97224345 AGCACAGATGGCCCCAAGCAGGG + Intronic
1112398916 13:99058814-99058836 TGCAGAGATGTCCCCAAAGCAGG - Intronic
1113039579 13:106090358-106090380 AACCAAAATGTTCCCAAATAGGG + Intergenic
1115851605 14:37594374-37594396 AGCACACTTCTCCCCAAATAGGG + Intronic
1117575082 14:57089612-57089634 AGCCAAGATGATCCCAAATTCGG - Intergenic
1117722694 14:58642859-58642881 TGCAAAGATATCCCAAAATAAGG - Intronic
1119611174 14:76063718-76063740 AGCAAAGGTGTTCCAAAAAAAGG - Intronic
1120477538 14:85007433-85007455 AGGCTAGATGTCCACAAATAAGG + Intergenic
1121885341 14:97537814-97537836 AGCTGAGATGTCCCTCAATAGGG + Intergenic
1126166066 15:45654939-45654961 AGACAAGATGGCCCCAACTAAGG - Intronic
1130193915 15:81761367-81761389 AGAAAAGCTGCCCCCAAAAAGGG - Intergenic
1130779119 15:87016438-87016460 TGCAAAGATGTTCCCAACAAAGG + Intronic
1131543613 15:93297270-93297292 ATCTAAGATATCCCCATATATGG + Intergenic
1131767442 15:95694815-95694837 AGAAAAGATGTGCCAAATTATGG - Intergenic
1133155261 16:3870084-3870106 AGTAAAGATATCCACAAATCGGG + Intronic
1134191394 16:12123898-12123920 AGTAAAGCTTTCCCCAAACACGG - Intronic
1137294064 16:47073409-47073431 AGCAAAACTGTCCCCAGACATGG - Intergenic
1137551895 16:49443157-49443179 AGCAAAGCTCTGCCCAAATGGGG + Intergenic
1140345108 16:74205926-74205948 AGCAAAGATGGCTTCAAAAAAGG + Intergenic
1140934502 16:79658024-79658046 AACAAATATGTCCCCAAACATGG + Intergenic
1141470997 16:84238420-84238442 AGCAAAGGCCTCCCCAAATGGGG - Intronic
1141900835 16:86989178-86989200 CGCAAAGATGTCCCAAGAGAGGG + Intergenic
1142317586 16:89357865-89357887 AGGAAAGGTGTCCCCAGAAAGGG - Intronic
1144927334 17:18823291-18823313 ATCAAAGATGACCCAAAAAAGGG + Intergenic
1148444840 17:47731256-47731278 AGCAAAAATGTCCCCCAAAGGGG + Intergenic
1148856902 17:50583903-50583925 GGCAAAGAGGGCCCCAAGTAAGG + Intronic
1150009427 17:61490535-61490557 GGCCAAGAAGCCCCCAAATATGG + Intergenic
1150416425 17:64992496-64992518 AGCAAATATGTCCCCATGCAAGG + Intergenic
1153328452 18:3847317-3847339 AGAAAGGATGACCCCAAATGTGG + Intronic
1157576303 18:48746146-48746168 AGCAAAGATGGCCCCACAGATGG - Intronic
1158334549 18:56401810-56401832 AACAAATTTGTCCCAAAATAGGG + Intergenic
1158639009 18:59186873-59186895 AGTAAAGATGTCCACATATTTGG + Intergenic
1159335882 18:67065398-67065420 AGCAAAGATTTGTCCAAATGAGG + Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG + Intronic
1164879462 19:31719319-31719341 TGCAAAGATGTCCACATACATGG + Intergenic
1167085886 19:47309598-47309620 AGAAGAGATGGCCCCAAATAGGG + Intronic
926076750 2:9949168-9949190 AGCACAGATGGTCCCAAATAGGG - Intergenic
928822208 2:35374726-35374748 AGCAAAGGGGAACCCAAATAGGG + Intergenic
929855124 2:45630951-45630973 AGAAAATATGTCCCATAATAAGG - Intergenic
930786721 2:55278685-55278707 AACAAGGATGTCCACCAATATGG + Intergenic
931762300 2:65429438-65429460 AGCAAAAATCTAACCAAATATGG + Intronic
932967572 2:76495285-76495307 GCCAAAGATGTCACCAAAGAAGG + Intergenic
935228858 2:101078680-101078702 TTCAAAGATGTCCCAAAATAGGG - Intronic
940958830 2:159759534-159759556 AGGAAAGTTGTTCCAAAATAGGG + Intronic
942094147 2:172522110-172522132 AGCAAGAATTTCCCCAAAGATGG + Intergenic
943388875 2:187236411-187236433 AACAAAGATGTCCCTCAAAAGGG - Intergenic
943417121 2:187621505-187621527 AACTAAAATGTCCCCAAATATGG - Intergenic
945109275 2:206347226-206347248 AGCCAAGATGTCCCTAATAAAGG - Intergenic
945621620 2:212146669-212146691 TGCAAAGACGTCCCTAACTACGG + Intronic
947101718 2:226628308-226628330 ACCAAAGATGGCCCCAAGGATGG - Intergenic
947847968 2:233260866-233260888 GGCAAAGATTTCCCCAGACAAGG - Intronic
1169897711 20:10522258-10522280 AGCTAAGATCCCCCCAAAAAAGG - Intronic
1170518891 20:17162497-17162519 AGCAAAGATTTGCACAAATATGG + Intergenic
1172938276 20:38636631-38636653 ATCAAAAATGTCCACTAATAGGG - Intronic
1173380765 20:42538611-42538633 AGCAATGATGTTCCCAATTTTGG - Intronic
1174542747 20:51302912-51302934 AGCCAGCATGTCCACAAATAAGG - Intergenic
1174601029 20:51724969-51724991 GGCACAGATGTCCCCCAATCTGG - Intronic
1175007419 20:55700081-55700103 AAAAATGATGCCCCCAAATAGGG - Intergenic
1180988394 22:19918893-19918915 ATCCAAGATGCCCCCAACTATGG - Exonic
1183017071 22:34997518-34997540 AGCAAAGATCTGTCCAAGTAGGG - Intergenic
1184082066 22:42229226-42229248 AGCAGAGATGTCCATAATTATGG + Intronic
1185183483 22:49378156-49378178 AGCAATGATATCCAAAAATAAGG + Intergenic
949228892 3:1727204-1727226 AGAAATGATATCCCAAAATATGG + Intergenic
949616972 3:5764546-5764568 AGCAAAGATGTCCAAAGTTATGG + Intergenic
949687008 3:6586992-6587014 AGCAAAGATTTCTTAAAATAGGG + Intergenic
951778301 3:26334822-26334844 GGCAAAGTTGTCCCTAAATCTGG - Intergenic
952361823 3:32637909-32637931 TGCAAAGATATTTCCAAATAAGG - Intergenic
956903615 3:73742536-73742558 GGCACAGAGGTCCCCAGATATGG - Intergenic
956934486 3:74084436-74084458 GAAAAAGATATCCCCAAATATGG - Intergenic
957490178 3:80915663-80915685 AGCAAAGAGATACCCAAATAAGG + Intergenic
959172336 3:102858430-102858452 AGAAAAGATGTTCAAAAATAAGG - Intergenic
961444956 3:126976017-126976039 ACCAAAGATGTTCCCAAGTATGG - Intergenic
963217846 3:142770981-142771003 AGCAAAGATGTCACATAGTAAGG + Intronic
963487183 3:145949790-145949812 AACAAAGATGTCTCCAATTAAGG + Intergenic
964135024 3:153335953-153335975 AGCAAATATTTCCCAAAACAAGG - Intergenic
964721936 3:159775805-159775827 AGCAAAGTTCTCTCCATATATGG - Intronic
964879804 3:161410814-161410836 AGCAATGATGGCCCCAAATTAGG + Intergenic
966559279 3:181301481-181301503 AGCAGACTGGTCCCCAAATAAGG + Intergenic
968401463 4:302106-302128 AGCAAAGTGCTCCCCAAATCTGG - Intronic
969557262 4:7920435-7920457 GAGAAAGATGACCCCAAATACGG - Intronic
970064612 4:12078057-12078079 AGTAAATATGTCCATAAATAAGG + Intergenic
970105744 4:12581297-12581319 AACCAAAATGTCCACAAATATGG - Intergenic
970178175 4:13360099-13360121 ACCAAAGATGTCCCCAGTAAAGG - Intergenic
973004963 4:44994722-44994744 AGAAAAGATGGGCCCAAAAATGG - Intergenic
973197839 4:47465831-47465853 AGCAAAGAAGTCCACATAGAAGG - Intergenic
973345327 4:49048750-49048772 AGAAGATATGTCTCCAAATATGG + Intronic
974844859 4:67340053-67340075 AGCCCAGATGTCCCCACAGATGG + Intergenic
975083385 4:70307609-70307631 AGCAAAGAAATCCGCAAACAGGG + Intergenic
977056200 4:92194995-92195017 AGCATAGCTGTTCCCAAAGAGGG - Intergenic
978319161 4:107475367-107475389 AACAAAAATGTCACCAAAAATGG + Intergenic
981111964 4:140945410-140945432 GCCAAAAATGTTCCCAAATAAGG + Intronic
982632609 4:157850966-157850988 AGAAAAGATCTCCCCACATAGGG + Intergenic
983992606 4:174139609-174139631 AGCTAAGATGTTACCAAATCTGG + Intergenic
991292990 5:65050801-65050823 TGCAAAGATCTTTCCAAATACGG + Intergenic
992955733 5:81906403-81906425 AGCAATGATGTCTCCAAAGCAGG - Intergenic
993415059 5:87617655-87617677 AGCTTATATTTCCCCAAATATGG + Intergenic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
994469787 5:100188379-100188401 AGAAAACATGACCCCAAAAATGG - Intergenic
997071210 5:130624446-130624468 AGCAAAGATAACCCTAAAGAAGG + Intergenic
999921267 5:156323749-156323771 AGCAAAGAGGTCACCATGTATGG + Intronic
1001577366 5:172772766-172772788 AGCAAAGAGGTCCTCAGATAAGG + Intergenic
1001778331 5:174345893-174345915 AATCAAAATGTCCCCAAATAGGG - Intergenic
1004976596 6:20974030-20974052 AACAAAGAGGCCCCAAAATATGG + Intronic
1005036192 6:21556910-21556932 AGCAAAGATGTTCCTAGGTAAGG + Intergenic
1005261366 6:24064329-24064351 AGCAAAGATGACCACAGTTAGGG + Intergenic
1005386162 6:25286952-25286974 AGCATTTATCTCCCCAAATATGG + Intronic
1005493636 6:26369834-26369856 AGAAAAGCTGTCCCAACATATGG - Intronic
1006874808 6:37285972-37285994 TGCAAAAATGTCCTAAAATAGGG - Intronic
1008486784 6:52044987-52045009 AGCCAACATGTCTCCAAATATGG + Exonic
1008878745 6:56358706-56358728 ACCAAACATGTCCCCAAGTCAGG + Intronic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009728658 6:67568922-67568944 AGCAAATATATCCATAAATAAGG + Intergenic
1009922519 6:70079912-70079934 AGCAAAGAAGTCTGTAAATAGGG + Intronic
1012450480 6:99349241-99349263 AGCGATGATGTCCCCATAAAAGG + Exonic
1013857304 6:114589498-114589520 AGAAAACATTTCCCCCAATACGG + Intergenic
1016649708 6:146449318-146449340 TGAAAAGATACCCCCAAATATGG - Intergenic
1016719373 6:147276290-147276312 AGCAAAGAAATAACCAAATATGG - Intronic
1017448382 6:154529972-154529994 TGCAAATCTGTTCCCAAATAAGG - Intergenic
1017637926 6:156461328-156461350 AGCAAAGTTGTCCAAAAATAGGG - Intergenic
1018652978 6:166006716-166006738 AGCAAAGACGTCAGCAACTAAGG + Intergenic
1019111605 6:169721590-169721612 AGCAAAAATATACCCTAATAAGG + Intronic
1021585047 7:22198946-22198968 ACCACAGATGTCCCCTAAGATGG + Intronic
1022286080 7:28957009-28957031 GGCGAAGATGTCCCCGGATAGGG + Exonic
1024341225 7:48263058-48263080 AGCAAAGATGTAAGCAAATCAGG - Intronic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1024953912 7:54895499-54895521 AGAAGAAATATCCCCAAATATGG - Intergenic
1026236243 7:68529495-68529517 TGCAAAGATGTCTAGAAATAGGG - Intergenic
1026897005 7:74015059-74015081 CAGAAAGAGGTCCCCAAATAAGG - Intergenic
1027614383 7:80403149-80403171 AGCATAGATAACCCCACATAAGG - Intronic
1030164033 7:106534984-106535006 AGTTAAGATCACCCCAAATAGGG - Intergenic
1030452872 7:109734911-109734933 AGCAAACATGTCCTTCAATAGGG + Intergenic
1030872983 7:114780657-114780679 AGCAAGGATGGCTCCAAACAGGG - Intergenic
1032303222 7:130709101-130709123 GGCAAAGATGTACACACATAAGG - Intergenic
1033685282 7:143634153-143634175 AGCAAAGGTGTCCCCAAAGTGGG - Intronic
1033688453 7:143713372-143713394 AGCAAAGGTGTCCCCAAAGTGGG - Intronic
1033699333 7:143823469-143823491 AGCAAAGGTGTCCCCAAAGTGGG + Intergenic
1033765531 7:144485787-144485809 AGCAAATATGTTTTCAAATAAGG - Intronic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1040009447 8:42649053-42649075 TCCTAACATGTCCCCAAATAAGG + Intergenic
1042536272 8:69861728-69861750 AGCAGAGATTTTCCCAAATTTGG + Intergenic
1043710250 8:83407483-83407505 AGGAAAAATGTCTCCAATTATGG - Intergenic
1043981452 8:86645483-86645505 AGAAAAGATGCCCCCCAAAAGGG + Intronic
1048328836 8:133458635-133458657 AGAAAAGATGTTCCCAGCTACGG + Exonic
1049565158 8:143334490-143334512 AGGGGAGATTTCCCCAAATAGGG + Intronic
1051505907 9:17827609-17827631 GGCAAAGATGTGCTCAAAGAAGG - Intergenic
1053491169 9:38504583-38504605 AGCAAAAATGGACCAAAATATGG + Intergenic
1057336751 9:94161654-94161676 AGCAAAGTCCTCCCTAAATAGGG + Intergenic
1058510795 9:105713910-105713932 AGCAGAGGTGGCCCCAAAGAGGG - Intronic
1059177621 9:112181602-112181624 CTCAAAGACGTCCCCAAAGAAGG - Intergenic
1059529127 9:115019494-115019516 AGCACACATTTCCCCAAAGAAGG + Intergenic
1060421453 9:123472444-123472466 AAGAAAGATGCCCCCAAATGAGG - Intronic
1062244826 9:135560739-135560761 GGCAAAAATCTCACCAAATATGG - Intergenic
1203649985 Un_KI270751v1:107369-107391 AGGAAAGATGGGCCCGAATAAGG - Intergenic
1186284479 X:8028645-8028667 AGCAAATATGTCCTAATATAAGG + Intergenic
1195307397 X:103597608-103597630 GGCAAAAATATTCCCAAATATGG + Intergenic
1198831460 X:140755216-140755238 ACTAAAGATGGCACCAAATATGG - Intergenic
1201417690 Y:13763791-13763813 TGCAAAGAAGTCCCCAAAACAGG - Intergenic