ID: 916552832

View in Genome Browser
Species Human (GRCh38)
Location 1:165865396-165865418
Sequence CATGCTTTGCAGGGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 1, 2: 1, 3: 31, 4: 318}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916552832_916552840 2 Left 916552832 1:165865396-165865418 CCCTCCACCCCCTGCAAAGCATG 0: 1
1: 1
2: 1
3: 31
4: 318
Right 916552840 1:165865421-165865443 AAGTGCAGCAGCAAGATCTGCGG 0: 1
1: 0
2: 1
3: 33
4: 355
916552832_916552842 16 Left 916552832 1:165865396-165865418 CCCTCCACCCCCTGCAAAGCATG 0: 1
1: 1
2: 1
3: 31
4: 318
Right 916552842 1:165865435-165865457 GATCTGCGGTGGCAAAAACCAGG 0: 1
1: 0
2: 0
3: 1
4: 69
916552832_916552841 5 Left 916552832 1:165865396-165865418 CCCTCCACCCCCTGCAAAGCATG 0: 1
1: 1
2: 1
3: 31
4: 318
Right 916552841 1:165865424-165865446 TGCAGCAGCAAGATCTGCGGTGG 0: 1
1: 0
2: 0
3: 12
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916552832 Original CRISPR CATGCTTTGCAGGGGGTGGA GGG (reversed) Intronic
901818194 1:11806745-11806767 GATGCTTTGCAGGGGGAAGCTGG - Intronic
902161259 1:14532230-14532252 TGGGCTTTGGAGGGGGTGGATGG - Intergenic
902684094 1:18064605-18064627 GATGCTGGGCAGGGGGAGGAGGG - Intergenic
904036785 1:27563411-27563433 CATGCTGTGTGGTGGGTGGAGGG - Intronic
904471601 1:30739893-30739915 CATGATTTGCAGGGACAGGAAGG + Exonic
904619803 1:31768417-31768439 CAGGCTATGCAGGGTCTGGAAGG - Intergenic
905776740 1:40672677-40672699 CATGCTCTATTGGGGGTGGAAGG + Intergenic
905933514 1:41806378-41806400 CATGCTTCAGAGGGGGTGAAGGG - Intronic
906117509 1:43366413-43366435 TGTACTGTGCAGGGGGTGGAGGG + Intronic
906476035 1:46170095-46170117 CATGCTTTTCTCGGGGTGGCTGG - Intronic
907303110 1:53500505-53500527 CATGGTTTGGAGGGGGCCGAGGG - Intergenic
907316048 1:53573364-53573386 CATAAATTGGAGGGGGTGGAGGG - Intronic
907987460 1:59546402-59546424 CTTGCTCTGCAGAGGGTGGGAGG + Intronic
915195278 1:154184358-154184380 CAAGGTTTGGAGGGGCTGGAAGG - Intronic
916463324 1:165048491-165048513 AATGCCTGCCAGGGGGTGGAAGG - Intergenic
916552832 1:165865396-165865418 CATGCTTTGCAGGGGGTGGAGGG - Intronic
917040349 1:170799197-170799219 CACGCTTGTCAGGGGGTGGGGGG + Intergenic
917062209 1:171053190-171053212 CTTGCTTTGAAGTGGGTGAAGGG - Intronic
918108971 1:181439176-181439198 CATGCTAGGCAGGGGGTTGAAGG + Intronic
919204601 1:194405895-194405917 GAGGCTTTTCAGGGAGTGGAGGG + Intergenic
919796655 1:201325171-201325193 CCTGCTGTGCAGGGTGAGGAGGG - Intronic
920061657 1:203230972-203230994 TATCCTTTGCGGGGGGTGGGAGG + Intronic
920345147 1:205301559-205301581 AATGCTCTGCAGGGGGCTGAGGG + Intergenic
920813751 1:209311447-209311469 CATACTTTGCAGGGCATGGATGG + Intergenic
921944656 1:220878598-220878620 CATCCTTTGCAGGAGGTTGTAGG - Intergenic
923125639 1:231032393-231032415 CATGCATTGCTGGGGGTGGGGGG - Intronic
923570485 1:235108787-235108809 AATGCTTTGGAGAGGGTGGAAGG - Intergenic
924072373 1:240294674-240294696 CAGGCTTTGCAGTGGGGGCAAGG + Intronic
924927498 1:248697109-248697131 CATGCTTTGCAGTGCAAGGAAGG + Intergenic
924940533 1:248810276-248810298 CATGCTCTTGCGGGGGTGGAAGG - Intergenic
1063295487 10:4800897-4800919 CAGGCTGTGCAGGAGGAGGATGG - Intronic
1063448621 10:6136257-6136279 CCTGCTCAGCAGGAGGTGGAGGG - Intergenic
1064128778 10:12689062-12689084 AATGCTTAGCAGCGGGAGGATGG + Intronic
1064404919 10:15053192-15053214 CATTCCTGGCTGGGGGTGGAGGG - Intronic
1064705690 10:18070139-18070161 CATGCTTTGAAGGTAGAGGAAGG - Intergenic
1064897475 10:20254349-20254371 CTTGCTTTGCAGCTGCTGGATGG + Intronic
1065454555 10:25893339-25893361 CAACCTTTACAGGGGATGGAAGG - Intergenic
1066450205 10:35521737-35521759 CCTGCTTTCCAGGGGCCGGATGG + Intronic
1067298007 10:44985829-44985851 CAAGCCTAGCAGGGGGTGGAAGG - Intronic
1067925803 10:50506944-50506966 CATGCTTTGCAGGGGTTTTGGGG - Intronic
1068025479 10:51637761-51637783 CCTGTTGGGCAGGGGGTGGAAGG + Intronic
1068852970 10:61765555-61765577 CATCCATTGCAGATGGTGGAGGG + Intronic
1069905801 10:71731344-71731366 CATGCATGGGATGGGGTGGAGGG + Intronic
1070053985 10:72916476-72916498 TGTCCTTTGCAGGGAGTGGATGG - Intronic
1070167057 10:73906853-73906875 CAGGCTGTGGAAGGGGTGGAGGG - Intergenic
1071497463 10:86178915-86178937 CAGGCATTGCAGAGGCTGGAGGG + Intronic
1073037090 10:100571625-100571647 CATGCGGGGCTGGGGGTGGATGG - Intergenic
1073442656 10:103561704-103561726 CCTGCCTTGCAGGGATTGGAGGG + Intronic
1073489215 10:103841579-103841601 CATGCTGTGCAGGGTGGGGAGGG + Intronic
1075438023 10:122459704-122459726 ACTGCTTTGCGGGAGGTGGAGGG - Intergenic
1075589157 10:123678819-123678841 CAGGCTGGGCAGGGTGTGGAGGG + Intronic
1075664896 10:124223086-124223108 CAGGCCTTGCAGGGGGTTCAGGG + Intergenic
1077182749 11:1223916-1223938 CAAGCTTGGGAGGGGGTGGAGGG - Intronic
1078879583 11:15434887-15434909 GATGCTTTGCATGTGGTGGAGGG + Intergenic
1079505954 11:21152156-21152178 AATGGAATGCAGGGGGTGGAGGG + Intronic
1080889766 11:36399234-36399256 CATTCTGAGCAGGGGGTGAAGGG + Intronic
1082248303 11:49951090-49951112 CATGCTTTGCAAGGGGATCAAGG + Intergenic
1086243309 11:84721203-84721225 CATGCCTTGCCGGGGGCAGAGGG + Intronic
1087011475 11:93518111-93518133 AATGGTTTCCAGGGGCTGGAGGG - Intronic
1087212656 11:95459417-95459439 CATGTTTTTCAGGAGGTGGCAGG - Intergenic
1089132197 11:116221538-116221560 AATGCTTTGGAGTGGGTGGGGGG - Intergenic
1089763754 11:120748279-120748301 AGTGCTTGGCAGGGGGTGGAAGG - Intronic
1090457428 11:126862079-126862101 CATGCTGTCCAGGTGATGGAGGG + Intronic
1091113890 11:132996023-132996045 CATGGATGGCAGGGGGAGGATGG - Intronic
1093390158 12:18608893-18608915 GATTCTGTGCAGGGGGTGGGAGG + Intronic
1093675388 12:21933213-21933235 TTTGCTTTTCAGAGGGTGGAGGG + Intronic
1094838977 12:34335106-34335128 CATGCGTGGCAGGGTGTGTAGGG - Intergenic
1095163976 12:38949885-38949907 AATGTATTGTAGGGGGTGGAAGG + Intergenic
1096233502 12:49910531-49910553 CAGGCTTTGAAGGGTGTGAAAGG - Intergenic
1096673481 12:53213950-53213972 CATGTGTGGCAGGGGGTGCAGGG + Intronic
1097996545 12:65893649-65893671 CCTGCATTTCAGGGGGTGAATGG + Intronic
1098218639 12:68245580-68245602 CAGGCTGTGCAGTGGCTGGAAGG - Intergenic
1100393516 12:94164517-94164539 CATGCATTCCAGGGTGTGAAAGG - Intronic
1102924179 12:116814368-116814390 CATTGTTTGCAGGGCGGGGAAGG + Intronic
1103941961 12:124506085-124506107 CCTGCTTTGCCTGGGGTGAAGGG - Intronic
1104486798 12:129158282-129158304 CATGCTTTGCAGGGGAGAGGAGG + Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1105821880 13:24087300-24087322 AATGCTTTGCAGAGTGTGCAGGG - Intronic
1108345797 13:49545973-49545995 TCTGCATTGCATGGGGTGGAGGG - Intronic
1112809102 13:103197024-103197046 CCTGCTTTGCAGGTGGGAGATGG + Intergenic
1113646985 13:112005091-112005113 CAGGCTGTGCAGTGAGTGGAGGG - Intergenic
1113774453 13:112934850-112934872 CAAGCATTGCAGGGAGTGGCGGG - Intronic
1116995975 14:51324943-51324965 GATGATTTTCAGGGGCTGGATGG - Intergenic
1118601055 14:67471763-67471785 CATACTGTGCAGGGTGTGGTGGG - Exonic
1118734290 14:68690867-68690889 CATGCCTTTCAGAGGGTGGGGGG - Intronic
1119225765 14:72943578-72943600 CATCATTTGCAGGGGGTGAAAGG + Intronic
1120473610 14:84958696-84958718 CATATTTTTCAGGGGGAGGAAGG + Intergenic
1120720631 14:87886732-87886754 GATGCTTTGGTGGGGGTGGGGGG - Intronic
1120727091 14:87956251-87956273 CAGGCTTTACAGTGTGTGGAGGG + Intronic
1121103832 14:91267843-91267865 CTCGCTTTGGAGGGGGAGGATGG + Intergenic
1121284962 14:92727874-92727896 CATGGTTTGCAAGGGGTGTAGGG - Intronic
1121425148 14:93845354-93845376 CATGCTTTGGGGAGTGTGGAGGG + Intergenic
1121629733 14:95413500-95413522 CCTGCCTTGCAGGGGATGGGAGG - Intronic
1122232731 14:100314927-100314949 CGTGCTTGGCAGGGAGTGGCTGG - Intergenic
1122628371 14:103096004-103096026 CCTTATTTGCAGGGGCTGGAAGG + Intergenic
1122877596 14:104676096-104676118 GATGCCTTGCTGGGGGTGGTGGG + Intergenic
1122889260 14:104724917-104724939 CAAGGTCTGCAGGTGGTGGAGGG + Intronic
1122975433 14:105168876-105168898 CAGGCTTTAAAGGCGGTGGAGGG + Intergenic
1123049291 14:105532838-105532860 GATGCTGAGCAGGGTGTGGACGG + Intergenic
1124035741 15:26052355-26052377 CTTCCTTTGCAGGCAGTGGAAGG + Intergenic
1124438732 15:29671941-29671963 CATGGCTTCCAGGGGCTGGAAGG + Intergenic
1124940535 15:34213516-34213538 CTTCCTTTGCAGGCTGTGGAAGG + Intergenic
1125889204 15:43253171-43253193 CCAGCTTTGCAGGGGATGGGAGG - Intronic
1127376176 15:58387118-58387140 CTTGCTTTGCATGGAGAGGATGG + Intronic
1127725068 15:61742165-61742187 CATACACTGCAGGGGGAGGAAGG - Intergenic
1128160022 15:65417423-65417445 CATGGTTTGCTGTGTGTGGAGGG - Intronic
1129727762 15:77910276-77910298 CATGCTTGGTGGGGGGTGGGAGG - Intergenic
1129840115 15:78738584-78738606 CATGCTTGGTGGGGGGTGGGAGG + Intergenic
1130271874 15:82455956-82455978 CATGCTTGGTCGGGGGTGGGAGG - Intergenic
1130464224 15:84183343-84183365 CATGCTTGGTCGGGGGTGGGAGG - Intergenic
1130488462 15:84411476-84411498 CATGCTTGGTCGGGGGTGGGAGG + Intergenic
1130500042 15:84490192-84490214 CATGCTTGGTCGGGGGTGGGAGG + Intergenic
1130543103 15:84836086-84836108 GCTGCTTTACACGGGGTGGAAGG + Intronic
1130586522 15:85187978-85188000 CATGCTTGGTCGGGGGTGGGAGG - Intergenic
1130708882 15:86259936-86259958 CACGCTTTGCAGAGGATGGAGGG + Intronic
1131066129 15:89435984-89436006 AATACTTTGCAGCGGGTGAATGG - Intergenic
1131189416 15:90301645-90301667 CATTCTTGGCAGGGGGTGGGAGG + Intronic
1131360688 15:91788201-91788223 CATGACTTTCGGGGGGTGGAGGG - Intergenic
1131525430 15:93148647-93148669 AATGCTTACCAGGGGCTGGAGGG - Intergenic
1131674144 15:94654328-94654350 AATGCTTTGGAGGGGTAGGAGGG - Intergenic
1131785817 15:95910390-95910412 TATGCTTTGATGGGGGTGGGTGG - Intergenic
1132018510 15:98339793-98339815 CTGGCTTTGAAGAGGGTGGAAGG - Intergenic
1132185215 15:99797648-99797670 CATGCTTGGTGGGGGGTGGGAGG + Intergenic
1132354190 15:101159252-101159274 CATGCTTTGTGGGGGGTGTAGGG - Intergenic
1132431773 15:101766907-101766929 CATGCTTGGTGGGGGGTGGGAGG - Intergenic
1132465167 16:74057-74079 GAAGCTTTGGAGGGGGTGGAGGG + Intronic
1132662808 16:1069136-1069158 CCTGCTTTTCAGTGAGTGGAGGG - Intergenic
1135830562 16:25769195-25769217 CAAGATTTGTTGGGGGTGGAAGG + Intronic
1138108326 16:54303742-54303764 CATGACTTTCAGGGGGTGGATGG + Intergenic
1138688072 16:58743648-58743670 AATGGTTTGCAGGAGGTGGGAGG - Intergenic
1139804696 16:69554735-69554757 CATGCTAGGCAGGAGGAGGAAGG - Intergenic
1141090327 16:81125867-81125889 CATGCCCTGAAGGTGGTGGAGGG + Intergenic
1141462079 16:84183602-84183624 CAGGCTTAGCAGGGAGAGGAAGG + Intronic
1142246933 16:88974493-88974515 TGTGCTGTGCAGGGGGTGGGAGG - Intronic
1144968472 17:19092537-19092559 CATGCTTTTCAGAGGCTAGAGGG + Intergenic
1144979445 17:19159526-19159548 CATGCTTTTCAGAGGCTAGAGGG - Intergenic
1144988777 17:19218706-19218728 CATGCTTTTCAGAGGCTAGAGGG + Intronic
1145038189 17:19555860-19555882 CATGCTGTGCATGGAGTGGTGGG + Exonic
1148836426 17:50468112-50468134 GATGCTTTTCAGGGGGTTGTGGG + Exonic
1149709366 17:58725984-58726006 TTTTTTTTGCAGGGGGTGGATGG - Intronic
1150048736 17:61938161-61938183 CAAGCTGAGCTGGGGGTGGAGGG + Intergenic
1151207435 17:72518311-72518333 AATGTTTGGCAGGGGCTGGAGGG + Intergenic
1151578599 17:74964920-74964942 CCTGCTTTGCCAGGGGAGGATGG - Intronic
1151949596 17:77343230-77343252 CTTGCCTCGCAGGAGGTGGATGG - Intronic
1152211772 17:79006243-79006265 CGGGCTTTGGAGGGGGAGGAGGG - Intronic
1152340810 17:79723385-79723407 CAGGGTATGAAGGGGGTGGAGGG + Intergenic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1154122778 18:11665067-11665089 GATGCTGTGCAGAGGGTGGCAGG - Intergenic
1156845880 18:41664795-41664817 CATGCCTGGCATGTGGTGGATGG + Intergenic
1158243000 18:55398567-55398589 CATGCTGTGCAGGCTCTGGAAGG - Intronic
1160060800 18:75527203-75527225 CCTCCTTTTCAGGGGGTGCAGGG - Intergenic
1161111970 19:2475720-2475742 CAAGTTCTGCTGGGGGTGGAGGG - Intergenic
1161165410 19:2784508-2784530 TTTGCTTTGGAGGGGCTGGAGGG - Intergenic
1161707659 19:5829609-5829631 CCAGCTTTGCGGGGGGTGGGGGG - Intergenic
1161729218 19:5948709-5948731 AATCCTGTGCAGGGGCTGGAAGG + Intronic
1162306776 19:9879516-9879538 CATTCATGGCAGGGGGTGAAAGG - Intronic
1162583839 19:11546983-11547005 CAGGCTGGGCAGGGGGTGGTGGG + Intronic
1162919641 19:13893023-13893045 CATGGTCTACAGGGGCTGGAGGG - Intronic
1164156119 19:22598389-22598411 TATGCTTGGCAGCGGGAGGAAGG - Intergenic
1164244179 19:23416148-23416170 CCTGTTTTCCTGGGGGTGGAGGG - Intergenic
1164767011 19:30780022-30780044 TATGCCTTGCAGAGAGTGGATGG - Intergenic
1164919492 19:32078177-32078199 AATGCTTGGCAGGGAGTGGAAGG - Intergenic
927207523 2:20619457-20619479 CCTGCTTTGCTGTGGGTGGGAGG - Intronic
930623980 2:53675894-53675916 CCTGCATTGCAGGGCATGGAGGG + Intronic
931224297 2:60316400-60316422 CATGCTGGGGAGGGGGTGAAAGG - Intergenic
932011176 2:67978712-67978734 CATGCTGTGTAGGGGAAGGAAGG - Intergenic
933278215 2:80304603-80304625 CATGCTTTGCGGGCGGCGGGCGG + Exonic
933638403 2:84732078-84732100 AATGCTGTGCAGGGGGTGTGGGG + Intronic
933983952 2:87575295-87575317 CCTGCTTTGCTGGGGCTGGGGGG + Intergenic
933993672 2:87651757-87651779 CAGGCTTGGCAGGTGGTGGTAGG + Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934543292 2:95193948-95193970 TATGCTTTGCAGGTGTTTGAAGG + Intergenic
934553860 2:95277376-95277398 CAAGGTTTGCAGGTGGTGCACGG - Exonic
934662082 2:96148455-96148477 CCTGCTGTGCAGGGGGCTGATGG - Intergenic
936023964 2:109017014-109017036 CATGCTTTGCATGGGAGGCAGGG - Intergenic
936269728 2:111040623-111040645 CAAGCTGGGCAGGGGGTGCAGGG + Intronic
936300191 2:111299126-111299148 CAGGCTTGGCAGGTGGTGGTAGG - Intergenic
936309903 2:111375501-111375523 CCTGCTTTGCTGGGGCTGGGGGG - Intergenic
937059022 2:118967699-118967721 CCTGCTGTGCGGGGGTTGGAAGG + Intronic
939009157 2:136825456-136825478 CAGGCTTTGAAGGTGGAGGAAGG - Intronic
939569996 2:143829890-143829912 CATGTTTTGCAGTGGGGGCAAGG + Intergenic
940614370 2:156032054-156032076 CATGCTAAAAAGGGGGTGGAGGG - Intergenic
941460875 2:165770126-165770148 CAGGCTTTGCAGGGGAGAGAGGG - Intronic
942461357 2:176171012-176171034 CATACTTTGCTGGGGGTTGGTGG + Intronic
942701792 2:178719502-178719524 CAATATTTCCAGGGGGTGGAGGG - Intronic
942968347 2:181925408-181925430 CATGCTATGGAGAGGTTGGAAGG - Intronic
943120733 2:183731973-183731995 CATCTTTTGGAGGGGATGGAAGG + Intergenic
945147896 2:206758190-206758212 CATGCTTTGCAGGGTGCAGAAGG - Intronic
947121473 2:226819565-226819587 GAGGCTATGCAGGGGGTGTATGG + Intergenic
947642478 2:231714717-231714739 CAGGCTGTGCAGGGGGTGTGGGG - Intergenic
947793182 2:232879207-232879229 CATGCCTCCGAGGGGGTGGAAGG - Exonic
1169251207 20:4062817-4062839 GCTGATTGGCAGGGGGTGGAGGG + Intergenic
1170150127 20:13220369-13220391 CATGCCTTGCAGTGGGCGGTTGG - Intergenic
1170728028 20:18947290-18947312 TGTGCTTTGCAGGAGGTGGTGGG - Intergenic
1170731861 20:18982965-18982987 CATCATTTGCAGGGAGTGGGAGG + Intergenic
1173618325 20:44417384-44417406 CATTCTCTGCAGGGGGTACAAGG - Intronic
1174036819 20:47673636-47673658 CATGCATTGAAGGGGATGGGAGG - Intronic
1174043028 20:47713335-47713357 CATTCTTTACGGGGGGAGGAGGG - Intronic
1174385758 20:50187749-50187771 CATCCCCAGCAGGGGGTGGAGGG + Intergenic
1175202736 20:57289355-57289377 CATCCTCTGCATGGGGTGGGGGG + Intergenic
1179191788 21:39128778-39128800 GATGGTTGCCAGGGGGTGGAGGG - Intergenic
1179290734 21:40015786-40015808 CATGCTTTGCAAGGAGGTGATGG - Intronic
1179628152 21:42660081-42660103 CTTGCTTCCCAGGGGGTGGTGGG + Intronic
1180163110 21:46006810-46006832 CATGCCTGGCAGGGGCTGGGAGG + Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1184639223 22:45860243-45860265 CATGAATTGTAGGGGGTGGGTGG + Intergenic
1185127277 22:49018133-49018155 AAGGCTATCCAGGGGGTGGAGGG - Intergenic
1185343832 22:50302890-50302912 CCTGCTTTGGAGGAGATGGAGGG - Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
952546445 3:34424908-34424930 CCTGCTTTGCAGTGGCTGAATGG + Intergenic
952639199 3:35571255-35571277 CATGCTTTGCAGGGAGAACAAGG + Intergenic
952764515 3:36943482-36943504 CATCCTCTGCGGGGGGTGGGGGG - Intronic
953392652 3:42542793-42542815 CCTGCTTTGTTGGGGTTGGAAGG - Intergenic
953437159 3:42887222-42887244 CTTGGGTTGCAGGGGGTGGGGGG - Intronic
954034586 3:47844430-47844452 CAAGCTTTGCAGTGGCTGGAGGG + Intronic
954309120 3:49750994-49751016 CTTGCTTTACAAGGTGTGGATGG + Intronic
954580320 3:51699689-51699711 TATGCTTGGCAGAGGGAGGAAGG + Intronic
954974450 3:54679704-54679726 CATGCTTCGCAGTGGGTTCAAGG + Intronic
955385428 3:58475535-58475557 CATGCAATGAAGGGGGTGCAGGG - Intergenic
956745255 3:72306029-72306051 CATGGTTGCCAGGGGCTGGAGGG + Intergenic
957364462 3:79204555-79204577 CATGCTTTGTAGTGGGTTGTGGG + Intronic
957550529 3:81697786-81697808 CCTGCTTTGGAGCAGGTGGAAGG + Intronic
958967026 3:100570519-100570541 CATGCTTTGGAGGAAGTGAATGG - Intronic
961478384 3:127163325-127163347 CAGGCTTTGGAGAGGGTGGAAGG + Intergenic
961787634 3:129357231-129357253 CCTGCTTTGCTGGGGGAGAAAGG + Intergenic
962095003 3:132284490-132284512 CATGCTTGGCAAGGGGGGGAGGG + Intronic
962237696 3:133721549-133721571 CATACTTTGCAGCTGTTGGATGG + Intergenic
962822397 3:139063245-139063267 CATGCTTTGCAGTTATTGGATGG + Intronic
962838635 3:139213669-139213691 CATGGTTTCCAGGGGATGGTAGG + Intronic
963289921 3:143477256-143477278 CATGATTTGCAGCTGGTGAAAGG - Intronic
964478305 3:157117072-157117094 CGTTCATTGCTGGGGGTGGAGGG + Intergenic
964812900 3:160684713-160684735 CATGTGTAGCAGGAGGTGGAGGG - Intergenic
966879550 3:184342234-184342256 CTCGCTTTGCAGCAGGTGGATGG + Exonic
967599737 3:191371236-191371258 CCTGCTTTGCAGGGTGGTGATGG + Intronic
968133788 3:196207832-196207854 CAGGCTTTCAAGGGGGTGGGCGG - Intronic
971851921 4:31995164-31995186 CATGCTTTGAAGGGGGTGGAGGG + Intergenic
972618466 4:40723067-40723089 CAAACATTGCAGGAGGTGGAGGG - Intergenic
974121966 4:57649663-57649685 CATTCATGGCAGGAGGTGGAAGG + Intergenic
974393846 4:61309590-61309612 CATGCTTTAAAGAGGTTGGAAGG + Intronic
974824078 4:67104357-67104379 CTTGCTGTGCAGGGCGTTGAAGG + Intergenic
976346266 4:84005218-84005240 CAGGCCTTTCAGAGGGTGGAGGG + Intergenic
977594973 4:98868559-98868581 TATGTTTTGCAGGGGGTAGGGGG - Intergenic
979104000 4:116661198-116661220 AGGGCTTTTCAGGGGGTGGAAGG + Intergenic
980422378 4:132580378-132580400 AATGCTGGACAGGGGGTGGAAGG - Intergenic
981060642 4:140420966-140420988 GATGGTTTCCAGGGGCTGGAGGG - Intronic
981234571 4:142399854-142399876 AATGCTTAGCAGGTGGGGGAGGG - Intronic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981420677 4:144546682-144546704 CTTTCTTTCCAGGGGGTGGGTGG + Intergenic
981637481 4:146897528-146897550 CATGATCAGCAGGGGGTGGCAGG - Intronic
981779627 4:148412248-148412270 CATTCTTTGCAGGGAGGGGTGGG + Intronic
983624022 4:169786663-169786685 CATAATTTTCAGGGGGTGGAAGG - Intergenic
985681992 5:1260646-1260668 CAAGCTTTGCAGGAGGGGGCTGG - Intronic
985730707 5:1546719-1546741 CCTGCTTTGCAGAGGATGGAAGG - Intergenic
986832240 5:11592719-11592741 CATGCTTTTCTGGGGGGGTAAGG + Intronic
987042220 5:14073579-14073601 CATGCTTTCCAGGAGTTGCAAGG + Intergenic
988425240 5:31056190-31056212 TAAGATTTGCAGGGAGTGGAGGG - Intergenic
988918354 5:35918451-35918473 CATGAACTTCAGGGGGTGGAGGG + Intronic
989056543 5:37371218-37371240 GATGCTTTCGAGGGGGTTGAGGG + Intergenic
990363902 5:55049500-55049522 CATGCTTTGAGGGAGGGGGAAGG + Intergenic
992906137 5:81347838-81347860 GATGGTTTGCATGGGGTGGGAGG + Exonic
994543291 5:101128142-101128164 CGTCCTTTGCAGGGCATGGATGG + Intergenic
994863713 5:105235098-105235120 CATACTTTGAAGGAGGTGGGAGG - Intergenic
997411678 5:133695768-133695790 CCTGGTTTGCAGGGAGGGGAGGG - Intergenic
997445974 5:133940665-133940687 CATCCTTGGCAGGGGGTGGGGGG - Intergenic
997756140 5:136400994-136401016 CAGGATTTGGAGGGGGTGGGGGG + Intergenic
998390405 5:141783750-141783772 CATGATTTGCAGGTGGGGGTGGG - Intergenic
998730074 5:145064742-145064764 CAGGCTTTGAAGAGGGAGGATGG + Intergenic
999273078 5:150309387-150309409 CCAGCGTGGCAGGGGGTGGAGGG - Intronic
999275238 5:150325654-150325676 CTTGGTGTGCAGAGGGTGGAGGG - Intronic
999767544 5:154753035-154753057 CCTGCTGTGTAGAGGGTGGAGGG - Intronic
1000050233 5:157556617-157556639 CCTTCATTGCAGGGTGTGGAAGG - Intronic
1000244095 5:159434624-159434646 AAGGCTTTGCAGGGGTGGGATGG + Intergenic
1001248562 5:170125364-170125386 CATACTTTGCAGGAAATGGAGGG - Intergenic
1003047442 6:2746877-2746899 CAGGCTTGGCAGCGGGTGGGTGG - Intronic
1003320810 6:5049429-5049451 CATGGTTTCCTGGGGGTGGCAGG - Intergenic
1006155236 6:32010024-32010046 CGTGCATTGTAGGAGGTGGAGGG + Intergenic
1006161542 6:32042758-32042780 CGTGCATTGTAGGAGGTGGAGGG + Exonic
1006412335 6:33881575-33881597 CAGGCTCTGCAGGGGGTGCCAGG - Intergenic
1017827372 6:158091916-158091938 CTTGCTTTCCAGGGACTGGAAGG + Intronic
1018710329 6:166494149-166494171 CTGGCTTTGCAGGGTATGGAGGG + Intronic
1019309549 7:353414-353436 CAGGGTCTGCAGGGGGTGGGGGG + Intergenic
1021608478 7:22433284-22433306 CATTATGTGGAGGGGGTGGAAGG - Intronic
1021608512 7:22433463-22433485 CATTATGTGGAGGGGGTGGAAGG - Intronic
1022342955 7:29486020-29486042 CAGGCTGGGCAGGAGGTGGAAGG - Intronic
1022356911 7:29624468-29624490 CATGTATTGGATGGGGTGGATGG - Intergenic
1022443201 7:30450323-30450345 CATGGGGTGCAGGGGGTCGAAGG - Intronic
1022576241 7:31499831-31499853 CATGTTTTGCTGGGGGTGGTGGG + Intergenic
1022975121 7:35549656-35549678 CTTGCTTTGCAGGGCATGAAGGG - Intergenic
1023925930 7:44669637-44669659 CATCATATGAAGGGGGTGGAGGG + Intronic
1024471562 7:49772687-49772709 TATGTGTTGGAGGGGGTGGAGGG + Intergenic
1026079995 7:67209279-67209301 TGTGCTTTGGAGGGGGTGGCTGG + Intronic
1026697094 7:72604750-72604772 TGTGCTTTGGAGGGGGTGGCTGG - Intronic
1030676224 7:112388678-112388700 CATGGTTACCAGGGGATGGAGGG + Intergenic
1030902349 7:115140202-115140224 CCAGCTTTGGAGGGGGTGCAGGG + Intergenic
1033299087 7:140170459-140170481 CATGCTGTCAAGGGGGTAGATGG - Intronic
1033351426 7:140565322-140565344 CATGCTTTTCTGGGGGTGGGGGG + Intronic
1033756662 7:144402217-144402239 CCTGCTTTGCAGGGAGGGGGAGG - Intronic
1037814000 8:22102446-22102468 CATGCTCTGCATGGTGTGGCAGG + Intronic
1038386436 8:27152315-27152337 CATGGTTTCCAGGTGCTGGAGGG + Intergenic
1038619179 8:29123813-29123835 CTTTCTTTGTAGGGGGTGGGAGG + Intronic
1040569804 8:48597723-48597745 CATGCAGTGCACGGGGAGGAAGG + Intergenic
1041324881 8:56653402-56653424 CATGCATTGCAGGGTGAGGCTGG - Intergenic
1041427414 8:57738403-57738425 CATGCATTGGTGGGGGTGGGTGG + Intergenic
1041709553 8:60881447-60881469 CAGGCTTTGCAGATGGAGGAAGG - Intergenic
1042821998 8:72939390-72939412 CAACCTTTTCAGGGGGTGGTTGG + Intergenic
1043937332 8:86156563-86156585 CATGCTGTGGAGGGGGTGGAGGG - Intergenic
1044449268 8:92314525-92314547 CATTCTTTGCAGAGAGTAGAGGG - Intergenic
1044586989 8:93877334-93877356 CATGCTTTGGGGGAGGTAGAAGG - Intronic
1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG + Intronic
1046631541 8:116626927-116626949 CAGGCTTTTCAGCAGGTGGAGGG + Intergenic
1047359114 8:124151904-124151926 CATGCTTGCGAGTGGGTGGAAGG - Intergenic
1048875178 8:138831569-138831591 CATGCTTTGCAGGATGAGCAGGG + Intronic
1048987082 8:139740460-139740482 CATGCTGGGCAGGGGGAGGCAGG + Intronic
1049081803 8:140449045-140449067 GGTGCTTTGCAGGGTCTGGAAGG - Intronic
1049288303 8:141788444-141788466 CATGCTGGGGAGGGGGTGGCTGG - Intergenic
1049746749 8:144266307-144266329 CACGCTTTGGCGGGGGTGGGGGG - Intronic
1049773242 8:144393360-144393382 CAGGATCTGCAGGGGATGGAAGG + Exonic
1056846838 9:90045725-90045747 CATTCTTTGCAGATGTTGGATGG + Intergenic
1057607800 9:96513420-96513442 CATGCTTGGCCTGGGTTGGAAGG - Intronic
1059416624 9:114166537-114166559 CAACCTTTGCAGGGGGTGATAGG + Intronic
1060483182 9:124029970-124029992 CATGCTTTCCCTGGGGTGGGGGG - Intronic
1060993564 9:127862492-127862514 CAGTCTTTGCGGGGGGTGGGGGG + Intergenic
1061061992 9:128255128-128255150 CATGCTTGGTAGGGGGTGGGAGG - Exonic
1061964116 9:134003610-134003632 CAGGCCTTGCACAGGGTGGATGG - Intergenic
1062161345 9:135081902-135081924 CATGCTTTGCACAAGGTGGCTGG + Intronic
1062403374 9:136382152-136382174 CATGCCCTGATGGGGGTGGAGGG - Intronic
1186081983 X:5943171-5943193 CTGGCTTTGAAGGGGGAGGAAGG + Intronic
1186770964 X:12817868-12817890 CATGCTTGGCAGGGCCTGGGGGG + Intronic
1186807731 X:13156565-13156587 TATGCTTTGCAGATGGAGGAAGG + Intergenic
1187504031 X:19864318-19864340 AAATCTTTGCAGGGGGTGGGGGG - Intronic
1189627781 X:42917922-42917944 CTTGCTTTGAAGTTGGTGGAAGG + Intergenic
1189795835 X:44645222-44645244 CATGCGCTGCAGGGGCAGGAAGG + Intergenic
1190720531 X:53143836-53143858 CTGGCTTTGCTGGGGATGGATGG - Intergenic
1191994255 X:67073930-67073952 CAGGCTTTTCAGAGGGTGGAGGG + Intergenic
1192185822 X:68946235-68946257 CCTCCTCTGCATGGGGTGGAGGG - Intergenic
1192226367 X:69230979-69231001 TGAGCTTTGGAGGGGGTGGATGG - Intergenic
1192262510 X:69514228-69514250 AATGCTTACCAGGGGCTGGAAGG - Intronic
1192809176 X:74534822-74534844 CTTGAGTTGCTGGGGGTGGAGGG - Intergenic
1194557405 X:95377421-95377443 CATGCTTTGCTGGGGATGCAAGG + Intergenic
1194936870 X:99960819-99960841 CCTTCTTTGGAGGGGGTTGAAGG - Intergenic
1198083493 X:133261727-133261749 CTGGCTTTGAAGGGGGAGGACGG + Intergenic
1198616492 X:138463600-138463622 CCTGCTTTGCTGGAGGTGGTAGG - Intergenic
1200043883 X:153389260-153389282 CATGCTTTGCAGTGTGTGTTGGG - Intergenic
1200052937 X:153444413-153444435 CCTGCTCAGCAGGGGGTCGAGGG + Intergenic
1200089077 X:153625969-153625991 CATGGTCTGAAGGAGGTGGAAGG + Intergenic
1200937272 Y:8749195-8749217 CATGTTTTGCTGGAGGAGGAGGG + Intergenic
1201389039 Y:13477352-13477374 CATTCTTTGGAGAAGGTGGAAGG - Intronic
1202370991 Y:24195295-24195317 CATGCTTGGTGGGGGGTGGGAGG + Intergenic
1202499793 Y:25474822-25474844 CATGCTTGGTGGGGGGTGGGAGG - Intergenic