ID: 916559804

View in Genome Browser
Species Human (GRCh38)
Location 1:165924916-165924938
Sequence CCTTCAGAACAGCTGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916559799_916559804 4 Left 916559799 1:165924889-165924911 CCACAGCACAGCAAAGTCCTGTT No data
Right 916559804 1:165924916-165924938 CCTTCAGAACAGCTGGAGGACGG No data
916559798_916559804 25 Left 916559798 1:165924868-165924890 CCACTAGAGGGTGAGAATGAGCC No data
Right 916559804 1:165924916-165924938 CCTTCAGAACAGCTGGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916559804 Original CRISPR CCTTCAGAACAGCTGGAGGA CGG Intergenic
No off target data available for this crispr