ID: 916563705

View in Genome Browser
Species Human (GRCh38)
Location 1:165955117-165955139
Sequence CCTGGGCTCCAGAAGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916563705_916563716 21 Left 916563705 1:165955117-165955139 CCCTCCCACTTCTGGAGCCCAGG No data
Right 916563716 1:165955161-165955183 AGGCAAGACTTCTGTTGCTGTGG No data
916563705_916563715 1 Left 916563705 1:165955117-165955139 CCCTCCCACTTCTGGAGCCCAGG No data
Right 916563715 1:165955141-165955163 ACAGATGTGGGAGGCTGAGCAGG No data
916563705_916563712 -8 Left 916563705 1:165955117-165955139 CCCTCCCACTTCTGGAGCCCAGG No data
Right 916563712 1:165955132-165955154 AGCCCAGGAACAGATGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916563705 Original CRISPR CCTGGGCTCCAGAAGTGGGA GGG (reversed) Intergenic
No off target data available for this crispr