ID: 916567199

View in Genome Browser
Species Human (GRCh38)
Location 1:165991368-165991390
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916567197_916567199 25 Left 916567197 1:165991320-165991342 CCTCCAAACATGCACTCTGATGT No data
Right 916567199 1:165991368-165991390 TAAAATGCATAGCTGCAACTAGG No data
916567198_916567199 22 Left 916567198 1:165991323-165991345 CCAAACATGCACTCTGATGTTGA No data
Right 916567199 1:165991368-165991390 TAAAATGCATAGCTGCAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr