ID: 916567834

View in Genome Browser
Species Human (GRCh38)
Location 1:165997101-165997123
Sequence TCTCATGTACTGGAGCTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916567831_916567834 -4 Left 916567831 1:165997082-165997104 CCAAGGTAAAGGATTATGTTCTC No data
Right 916567834 1:165997101-165997123 TCTCATGTACTGGAGCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916567834 Original CRISPR TCTCATGTACTGGAGCTGAT GGG Intergenic
No off target data available for this crispr