ID: 916568308

View in Genome Browser
Species Human (GRCh38)
Location 1:166002564-166002586
Sequence TATGATCCTGGACATAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916568308_916568315 13 Left 916568308 1:166002564-166002586 CCATGCCTATGTCCAGGATCATA No data
Right 916568315 1:166002600-166002622 CTTCCAGGTTTTTATAGTTTTGG No data
916568308_916568313 -2 Left 916568308 1:166002564-166002586 CCATGCCTATGTCCAGGATCATA No data
Right 916568313 1:166002585-166002607 TATTGCCTGGGATGTCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916568308 Original CRISPR TATGATCCTGGACATAGGCA TGG (reversed) Intergenic
No off target data available for this crispr