ID: 916569196

View in Genome Browser
Species Human (GRCh38)
Location 1:166009983-166010005
Sequence AACAACTTGGAAAGGTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916569196_916569206 23 Left 916569196 1:166009983-166010005 CCCTCAGACCTTTCCAAGTTGTT No data
Right 916569206 1:166010029-166010051 ACTTACATGTTGGTGCTTGAGGG No data
916569196_916569203 13 Left 916569196 1:166009983-166010005 CCCTCAGACCTTTCCAAGTTGTT No data
Right 916569203 1:166010019-166010041 CACTGCCAGTACTTACATGTTGG No data
916569196_916569205 22 Left 916569196 1:166009983-166010005 CCCTCAGACCTTTCCAAGTTGTT No data
Right 916569205 1:166010028-166010050 TACTTACATGTTGGTGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916569196 Original CRISPR AACAACTTGGAAAGGTCTGA GGG (reversed) Intergenic
No off target data available for this crispr