ID: 916572247

View in Genome Browser
Species Human (GRCh38)
Location 1:166038085-166038107
Sequence CAGACTAACCACCATGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916572247_916572251 -7 Left 916572247 1:166038085-166038107 CCAACCACATGGTGGTTAGTCTG No data
Right 916572251 1:166038101-166038123 TAGTCTGCTTCCTGGGAATGAGG No data
916572247_916572254 3 Left 916572247 1:166038085-166038107 CCAACCACATGGTGGTTAGTCTG No data
Right 916572254 1:166038111-166038133 CCTGGGAATGAGGCCATGATGGG No data
916572247_916572252 2 Left 916572247 1:166038085-166038107 CCAACCACATGGTGGTTAGTCTG No data
Right 916572252 1:166038110-166038132 TCCTGGGAATGAGGCCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916572247 Original CRISPR CAGACTAACCACCATGTGGT TGG (reversed) Intergenic
No off target data available for this crispr