ID: 916576613

View in Genome Browser
Species Human (GRCh38)
Location 1:166072589-166072611
Sequence TGAAATAACCATACTGGAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916576611_916576613 -2 Left 916576611 1:166072568-166072590 CCAATCTGCTCATTGGGTTCATG 0: 1
1: 0
2: 0
3: 11
4: 121
Right 916576613 1:166072589-166072611 TGAAATAACCATACTGGAGTCGG 0: 1
1: 0
2: 2
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916576613 Original CRISPR TGAAATAACCATACTGGAGT CGG Intronic
904868598 1:33602209-33602231 TCAAATAAACATAGTGGAATGGG - Intronic
906308143 1:44734321-44734343 TGAAATAAGCATAATGGGCTAGG - Intergenic
907812077 1:57880981-57881003 TGAAATAAGAAGAATGGAGTTGG + Intronic
909703256 1:78551805-78551827 TGATATAGACATACTGGAGACGG - Intergenic
910849033 1:91633037-91633059 TGAAAAAACAATACTGAAGATGG - Intergenic
911309048 1:96269839-96269861 TGAAACAACCTTACTGAAGGGGG - Intergenic
911783572 1:101914993-101915015 TGAAATATACATACTTTAGTAGG - Intronic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
913353838 1:117895918-117895940 TGAAAAAAGCATACAGGAGGTGG + Intronic
915452364 1:156015014-156015036 TGAAATAACCAGCCTTGAGAGGG + Exonic
916576613 1:166072589-166072611 TGAAATAACCATACTGGAGTCGG + Intronic
916755135 1:167762043-167762065 TGAAACTACGATTCTGGAGTGGG + Intronic
918753397 1:188303504-188303526 AGAAATAACCATACTTTTGTTGG - Intergenic
918963421 1:191308684-191308706 TGAAATAAACCTAGTAGAGTCGG + Intergenic
919435895 1:197560603-197560625 GTAAATACCCACACTGGAGTAGG + Intronic
1066405014 10:35110182-35110204 TGAAATAGCCATACTGCTATAGG + Intergenic
1066569837 10:36759175-36759197 TAAAGTAACCCTACTGAAGTAGG - Intergenic
1069215867 10:65819510-65819532 TAAAATCACCATACTTAAGTTGG - Intergenic
1070017180 10:72544796-72544818 TGGAGTAATCATACTTGAGTAGG - Intronic
1071802486 10:89079070-89079092 TGAAATAAAAATGGTGGAGTAGG + Intergenic
1071931120 10:90471479-90471501 TGAAACAACCTTACTGAAGGTGG - Intergenic
1073724739 10:106216915-106216937 GAAAATAGGCATACTGGAGTAGG + Intergenic
1075224614 10:120616192-120616214 TAAAACAACAATACTGGAATTGG + Intergenic
1079241406 11:18724649-18724671 TGACTAAGCCATACTGGAGTGGG + Intronic
1081019647 11:37929647-37929669 TGAAATAAAGATACTGGGGAAGG + Intergenic
1086270367 11:85056172-85056194 TGAAATAACCATAATCGACATGG + Intronic
1088164718 11:106920192-106920214 TGAAATAACCATTCTCGGTTTGG - Intronic
1091071496 11:132568454-132568476 AGACATAACTATACTGGATTAGG + Intronic
1091150304 11:133322484-133322506 TGAATTAACAAGACTGGGGTGGG + Intronic
1100077168 12:90799759-90799781 AGAAATACACATGCTGGAGTAGG - Intergenic
1102544534 12:113645198-113645220 TGAAATGATCATACTGAAGTAGG + Intergenic
1105597702 13:21854927-21854949 GGAAATCACCATCCTGAAGTGGG + Intergenic
1105609848 13:21958715-21958737 TGCAATAAACATACTGGTGCAGG + Intergenic
1105914371 13:24899148-24899170 TGAATTAACAAGCCTGGAGTTGG - Intronic
1107208910 13:37828295-37828317 AAAAATAACCATTCTGGAGGGGG - Intronic
1108756189 13:53505176-53505198 TGTAATAACCATAGAGGAGCAGG - Intergenic
1111284872 13:86076187-86076209 TGAAACAACAAAACTAGAGTGGG + Intergenic
1111838364 13:93417560-93417582 TGAAATAACCAAAATGAGGTGGG + Intronic
1112294415 13:98174037-98174059 TGAAATAAACATTCTGGAGTTGG - Intronic
1115673581 14:35644464-35644486 TTATATAACCATACTGAAGTGGG + Intronic
1117218087 14:53572670-53572692 TGAAATAAGCATACCAGACTGGG - Intergenic
1117265598 14:54083317-54083339 TGAATTAACCAGACTGCAGTGGG + Intergenic
1120286507 14:82508593-82508615 TAAAATAACTATGCTGAAGTGGG + Intergenic
1120384029 14:83821149-83821171 TGGAAGAATCATACTGGAGGAGG - Intergenic
1123848836 15:24332875-24332897 TGAAATAAGCTCACTAGAGTGGG - Intergenic
1126695322 15:51321082-51321104 TGAAGTAAGCAGGCTGGAGTGGG - Intronic
1128002152 15:64203167-64203189 TGAACTGACCCTACTGGAGTAGG + Exonic
1128032246 15:64491304-64491326 TGTAGTAACCATACTGAAGCTGG + Intronic
1128695485 15:69758968-69758990 TGAAATAATCATTCTAAAGTAGG - Intergenic
1128910831 15:71512810-71512832 TGAAACATCCATACGAGAGTAGG + Intronic
1131734794 15:95320465-95320487 TGAAATTACCATAAAGGACTGGG - Intergenic
1131973729 15:97919656-97919678 TGGAATAACCAGAATGAAGTGGG + Intergenic
1138780945 16:59785100-59785122 TGAAACAACCTCACTGAAGTGGG - Intergenic
1139377155 16:66506961-66506983 TAACATAACCATACTGAAGGGGG - Intronic
1139535633 16:67571305-67571327 TAATATAACCCTCCTGGAGTTGG + Intronic
1141933857 16:87223209-87223231 TGAAAGATCCATGCTGGAGAAGG + Intronic
1144943434 17:18957294-18957316 TGGAATAAAAATTCTGGAGTCGG - Intronic
1148906434 17:50915290-50915312 TGAAATAACCTCGCTGGACTTGG - Intergenic
1150045566 17:61909943-61909965 TGAAATAAACATACAAGTGTAGG + Intronic
1151003849 17:70411139-70411161 TAAAATAACCATACAGCTGTTGG + Intergenic
1153163891 18:2240433-2240455 CGTAATAACCAGACTAGAGTTGG + Intergenic
1155021683 18:21902399-21902421 TGAAATAAACCTACTGGCTTTGG - Intergenic
1155886567 18:31215995-31216017 TTATTTAACCATACTTGAGTGGG - Intergenic
1156960642 18:43025472-43025494 TGCAATAAACATACAGGTGTAGG - Intronic
1157095602 18:44682991-44683013 TGGAATAAACAAACTGGAGGTGG + Intronic
1159513056 18:69421475-69421497 TGCAATAACCCTATGGGAGTTGG - Intronic
1164386450 19:27774782-27774804 TGTAACACCCAGACTGGAGTGGG - Intergenic
1165899759 19:39163645-39163667 TGAAATAAACATTTTAGAGTAGG + Intronic
1166672373 19:44718726-44718748 TCAAATAACCACACTGGGGAGGG + Intergenic
1166815480 19:45542208-45542230 TGAAATAAACACACTGAAGATGG + Intronic
926053555 2:9760244-9760266 TGATATAACCAGGCTGGATTAGG - Intergenic
926070173 2:9881870-9881892 TGAAAGAACCATTAAGGAGTGGG - Intronic
926448684 2:12975452-12975474 TGAAATAACCACTCTGAAGAGGG + Intergenic
931635932 2:64340797-64340819 TGAAATATTCAAACAGGAGTGGG + Intergenic
931865030 2:66400156-66400178 TGATGAAATCATACTGGAGTAGG + Intergenic
933048057 2:77564070-77564092 TGAAATAGCCTTACTGAAGGAGG + Intronic
933118747 2:78508089-78508111 TGAACTAGACATGCTGGAGTGGG - Intergenic
934876744 2:97928559-97928581 TGAATCAACCTTACTGAAGTGGG + Intronic
937709712 2:124965568-124965590 TAAAAGAAACATACTGGATTTGG + Intergenic
938317565 2:130340569-130340591 TGAAAAACACATAATGGAGTGGG - Intronic
938556583 2:132430239-132430261 TGATATAAATAGACTGGAGTAGG - Intronic
945453891 2:210026482-210026504 TGAAATATTCATAGTTGAGTTGG - Intronic
945722457 2:213435001-213435023 TGCAATAACCATACAAGTGTAGG - Intronic
946063276 2:216963986-216964008 TGAAATAACAATAAAGGATTTGG + Intergenic
946787682 2:223264986-223265008 TGAGGTTATCATACTGGAGTAGG - Intergenic
947553593 2:231067090-231067112 TGAAAAGACCATACTGGAGTCGG + Exonic
1169039379 20:2480451-2480473 TGGATTAATTATACTGGAGTGGG + Intronic
1169051437 20:2581945-2581967 TGGGAAAACCATACTGGAGTGGG + Intronic
1173237738 20:41263226-41263248 TGAAATAATGATAATGAAGTTGG + Intronic
1173277030 20:41594229-41594251 TGAAAATACCATAGTGGAGAAGG - Intronic
1175703243 20:61155862-61155884 TGAAATAACCATATTAGGCTGGG + Intergenic
1179095175 21:38307930-38307952 TGAAATAAGCATTCTGGAGCAGG - Intergenic
954328120 3:49874764-49874786 TGAAATACCCCTACATGAGTAGG + Intergenic
956980447 3:74630324-74630346 AGAAATAACCGTCCTAGAGTTGG + Intergenic
957188281 3:76972036-76972058 TCAAATAACCATATTGAAGATGG + Intronic
959626378 3:108456773-108456795 TAAAATCAGCATACTGCAGTCGG + Exonic
960325262 3:116287754-116287776 TGAAATGATCAAACTGGAGGTGG - Intronic
961803539 3:129471494-129471516 ACAAATAACCACACTGCAGTGGG + Intronic
961942352 3:130650995-130651017 TGAAATAAGCATAACAGAGTTGG + Intronic
962005820 3:131348663-131348685 TGAAATAAACATACTAGATATGG + Intronic
962342377 3:134596428-134596450 TGAAGTAACCACCCTGGAGGAGG - Intergenic
965954429 3:174351612-174351634 TGAAATAACCTCACTGAATTGGG - Intergenic
968417324 4:451608-451630 TGTAATAACCAAATTGCAGTGGG - Intronic
971548866 4:27923397-27923419 TCAAATAACCATACTGAGATTGG + Intergenic
976517010 4:85980500-85980522 TGCAGTAACCATACTGGTGTTGG - Intronic
977829561 4:101574581-101574603 TGCAATAAACATGCTGGTGTAGG + Intronic
978041830 4:104074353-104074375 TCAAATAACAATTCTGGAATTGG + Intergenic
978380765 4:108126002-108126024 TGAAACAACTTTACTGGAATAGG + Intronic
979270493 4:118754688-118754710 TGACATGACTAAACTGGAGTTGG - Intronic
979616966 4:122753834-122753856 TAAAACAACCTTGCTGGAGTGGG - Intergenic
980618701 4:135268628-135268650 GGAAATAACCATAGTGGGGGGGG + Intergenic
983031842 4:162812596-162812618 TGGAATAAGCATCCTGGAATTGG - Intergenic
989050105 5:37311633-37311655 TGAAATATCCATACAGGACAAGG + Intronic
992340346 5:75816750-75816772 TAAAATAACTTTACTGGAATGGG + Intergenic
994724084 5:103414098-103414120 TTATATAACTATAATGGAGTAGG - Intergenic
999522782 5:152369577-152369599 TCCAATAAACATAATGGAGTTGG + Intergenic
999962657 5:156773719-156773741 TAAAATAACCATAATCTAGTTGG - Intergenic
1001900856 5:175428287-175428309 TGAAACAACCTTACTGAAGGGGG + Intergenic
1004494486 6:16150834-16150856 TACAATAAACATACTGGAATGGG - Intergenic
1005699518 6:28386415-28386437 TGAAATAACAATAACGGGGTGGG - Intronic
1006440190 6:34049166-34049188 TGCAAAAGCCAGACTGGAGTTGG - Intronic
1007002259 6:38325234-38325256 GGAAATAAACATACTAGAGATGG + Intronic
1012128665 6:95463003-95463025 TGATATAACCATTTTGGAGAGGG - Intergenic
1014070115 6:117171635-117171657 TGAAACAACCTCACTGAAGTTGG + Intergenic
1016733798 6:147454080-147454102 TTAAATAAGATTACTGGAGTGGG + Intergenic
1019232357 6:170578576-170578598 TGACATAACCACACTGGAGGTGG + Intronic
1021274411 7:18631769-18631791 TGAAATAAGGATGTTGGAGTAGG - Intronic
1021729179 7:23579941-23579963 TTAATTAAGTATACTGGAGTGGG + Intergenic
1022210000 7:28199245-28199267 TGAACTGACCATAGAGGAGTTGG + Intergenic
1024869463 7:53945704-53945726 TGAAATAACCATTCAGGCTTTGG - Intergenic
1026530163 7:71190251-71190273 TGTAATACCAATGCTGGAGTTGG + Intronic
1028349674 7:89830478-89830500 GGAAATTTCCATACTGGAGAAGG - Intergenic
1030979125 7:116165478-116165500 ACAAATAACCATACTGAAGTTGG - Intergenic
1037339519 8:17829052-17829074 TGAAATAACCAGATAGGTGTTGG - Intergenic
1039836160 8:41258006-41258028 TGTAATAAACATACAGGTGTAGG + Intergenic
1040836279 8:51734882-51734904 TGAAATAAACATAATAGGGTTGG + Intronic
1045560187 8:103254361-103254383 TGAGATATCCATACTGGAAATGG + Intergenic
1046032803 8:108803981-108804003 TGAAAGCAATATACTGGAGTGGG + Intergenic
1048762328 8:137808708-137808730 GGAAATAAACATACAGGACTGGG + Intergenic
1051118065 9:13720138-13720160 TGAAATAATCATCCTTGAGGGGG - Intergenic
1051483376 9:17582978-17583000 AGATAAAATCATACTGGAGTAGG - Intronic
1051755504 9:20395222-20395244 TGAAATACCCAGTATGGAGTTGG - Intronic
1051833136 9:21303528-21303550 AGTACAAACCATACTGGAGTAGG - Intergenic
1059602279 9:115792397-115792419 TGAAATAAACATAGTTAAGTGGG - Intergenic
1186630521 X:11343922-11343944 TGTCATAACCATACTGGGATAGG - Intronic
1190387439 X:49896692-49896714 TCAAATGTCCATACTGGTGTGGG + Intergenic
1197412667 X:126138644-126138666 TGACATAAGCATACAGCAGTGGG - Intergenic
1201678265 Y:16612444-16612466 TGAAATAATTATAGTGGAATTGG + Intergenic