ID: 916579443

View in Genome Browser
Species Human (GRCh38)
Location 1:166094471-166094493
Sequence AGTTCTGGGTCCATAGTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916579443_916579445 -10 Left 916579443 1:166094471-166094493 CCAATCACTATGGACCCAGAACT 0: 1
1: 0
2: 1
3: 11
4: 95
Right 916579445 1:166094484-166094506 ACCCAGAACTGCCTGTGGCCAGG 0: 1
1: 0
2: 2
3: 41
4: 298
916579443_916579449 3 Left 916579443 1:166094471-166094493 CCAATCACTATGGACCCAGAACT 0: 1
1: 0
2: 1
3: 11
4: 95
Right 916579449 1:166094497-166094519 TGTGGCCAGGCTGCACTGTGTGG 0: 1
1: 0
2: 4
3: 27
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916579443 Original CRISPR AGTTCTGGGTCCATAGTGAT TGG (reversed) Intronic
900928681 1:5721984-5722006 ATTTCTCTGGCCATAGTGATTGG + Intergenic
907557079 1:55353268-55353290 GGTTCTGGGTCCCTAGCCATGGG - Intergenic
912094921 1:106127543-106127565 AGTGCTGGATCCACAGGGATTGG + Intergenic
915781002 1:158549998-158550020 CTTTCTTGGTCCATAGTGATAGG + Intergenic
916579443 1:166094471-166094493 AGTTCTGGGTCCATAGTGATTGG - Intronic
917942730 1:179939260-179939282 AGTTATTGGTTCATAGTGGTTGG - Intergenic
920324368 1:205150688-205150710 AGTTCAGGGGCCATATGGATTGG + Exonic
920693369 1:208163671-208163693 AGTTCTGGTTCCCTAGTTACAGG + Intronic
922119724 1:222652880-222652902 AGGTCTTAGCCCATAGTGATAGG + Intronic
923959339 1:239059094-239059116 GAATCTGGGTCTATAGTGATCGG - Intergenic
1066289200 10:33998541-33998563 AGTTCTTGGGCCATAGGGTTTGG + Intergenic
1071106516 10:82103746-82103768 AGTTCTGAGGCCAGAGAGATGGG + Intronic
1072164583 10:92800741-92800763 AATTCTGGTTCCATAGGAATGGG - Intergenic
1072593585 10:96850107-96850129 AGTTCTAGGTTGAAAGTGATGGG + Intronic
1074351176 10:112738487-112738509 AGTTCTTGGTCCTCAGTGAACGG + Intronic
1077482905 11:2824919-2824941 AGTTCTGGGGCCTCAGTGACTGG + Intronic
1081012311 11:37829729-37829751 AGTTCTGTGCCTATAGTGATGGG + Intergenic
1085899140 11:80676753-80676775 AATTCTGGGTCCAGAGTGCCTGG + Intergenic
1087300543 11:96428652-96428674 AGTTTTGGGTCTTAAGTGATAGG + Intronic
1088566691 11:111180084-111180106 GGTTCTGGGGCCAGAGTGCTGGG + Intergenic
1100949329 12:99828410-99828432 AGCTCTGAGTTCATAGTGTTGGG - Intronic
1101789531 12:107914297-107914319 AGCAGTGGCTCCATAGTGATTGG - Intergenic
1102660549 12:114523766-114523788 AGTTCTGGTTACATAGAGCTAGG + Intergenic
1102736674 12:115167640-115167662 AGTTCTAGGGGCAGAGTGATGGG - Intergenic
1103835879 12:123820672-123820694 AGCTCTGGGTACATTGTAATAGG - Exonic
1107422780 13:40264496-40264518 AGATCTGGGTCTAGAGAGATTGG + Intergenic
1110142517 13:72148435-72148457 AGCTCTGGGTACATAGTTAATGG - Intergenic
1116451710 14:45074555-45074577 ATTTGTAGGTCAATAGTGATAGG - Intergenic
1118016991 14:61670684-61670706 AGTTCTGGGTCCTTGAAGATAGG + Intergenic
1118360476 14:65052561-65052583 AATTCTTTGACCATAGTGATTGG + Intronic
1120105704 14:80491682-80491704 GGGTCTGGGTGCAGAGTGATCGG - Intronic
1127200364 15:56640371-56640393 AGCTCTGTCTCCAAAGTGATGGG + Intronic
1132305108 15:100806405-100806427 ACTTTTGGGTCTATAGTCATAGG - Intergenic
1134508272 16:14825014-14825036 ATTGCTGGGTCCAAAGTGTTTGG - Intronic
1134975855 16:18570909-18570931 ATTGCTGGGTCCAAAGTGTTTGG + Intergenic
1135222151 16:20622775-20622797 AGTCCTGGGTCCCTAGAGGTTGG + Intronic
1139984462 16:70886690-70886712 GATTCTGGGTCCACAGTTATTGG + Intronic
1142426064 16:90002959-90002981 GTTTCTGGGTCCATGGTCATAGG + Intergenic
1148236695 17:45973948-45973970 AGTCCTTGGTCCATTTTGATTGG - Intronic
1156263406 18:35465635-35465657 ATTTCTGAATCCATAGTCATTGG - Intronic
1158230393 18:55248465-55248487 AGTTATTGGTACATAGTCATGGG - Intronic
1165433016 19:35783001-35783023 AGTGCTGGGTCCCCAGTGCTAGG - Intronic
1166591846 19:44006402-44006424 AATTCTGAGTCCATATTGTTGGG - Intronic
1168508937 19:56959216-56959238 AGATTTAGGACCATAGTGATGGG + Intergenic
927887466 2:26727541-26727563 GGGTCTGGGTCCACAGTGATGGG - Intronic
928105248 2:28466471-28466493 AGTTCTGCGCCCGTAGTGCTGGG + Intronic
930185893 2:48411671-48411693 ACTTCTGGGCTCAAAGTGATCGG + Intergenic
930767284 2:55097000-55097022 AGTACTGGGGCCACAGTGAGGGG - Intronic
936391758 2:112081222-112081244 ATTTCTGGTTCCAGAGTGACTGG + Intronic
946691871 2:222315246-222315268 AGTTCTGGGCACATAGTGAGTGG - Intergenic
947178208 2:227388580-227388602 AGCTCTGGGTCCTGAGTGGTGGG - Intergenic
1170983143 20:21234427-21234449 AGGTCTGGGTCCAGAGTGCGTGG + Intronic
1174875758 20:54224525-54224547 GGTCATGGGTCCATAGTTATTGG + Intronic
1175483723 20:59329722-59329744 AGTGCTGGCTCCATTGTGATTGG + Intergenic
1175882178 20:62266492-62266514 CGTTCTGGATCCGCAGTGATTGG + Intronic
1175882190 20:62266585-62266607 CGTTCTGGATCCGCAGTGATTGG + Intronic
1179225836 21:39452124-39452146 TCTTCTGGGTCCATAGCGGTAGG + Exonic
952552586 3:34496048-34496070 AGCTCTAAGTCCATAGTGCTGGG - Intergenic
958185918 3:90118725-90118747 AGTTGTGGGACCAAAGGGATGGG + Intergenic
959234639 3:103704069-103704091 AGTTCTTGCTTCATAATGATTGG - Intergenic
959372689 3:105548239-105548261 AGTTCTGAATCCCTAGTGGTAGG - Intronic
959633053 3:108530805-108530827 ATTTCTAGGTCCATTTTGATTGG - Intergenic
965617950 3:170613882-170613904 AGTTCTGTGTTCATGGTGAGAGG - Intronic
969036647 4:4259188-4259210 AGTTGTGGGTCTATAGGGATAGG - Intergenic
972029290 4:34432643-34432665 AGTTCTGGCACCATCGTCATTGG - Intergenic
972669841 4:41204643-41204665 AGCTCTGGGTCTATAGAGAAAGG - Intronic
980286506 4:130784741-130784763 AGGTCTGGGTGCATACAGATTGG - Intergenic
982589709 4:157292037-157292059 AGTTCTTAGTCAATAGTGATTGG + Intronic
983773587 4:171578747-171578769 AGATCTGGGTGCATGGTGTTTGG + Intergenic
986479413 5:8170679-8170701 ATTTCTGGGTACATACTGAAAGG + Intergenic
995038356 5:107560874-107560896 AGTTCTGGATCCTTAGAGCTTGG - Intronic
997744191 5:136284546-136284568 ACTTCTGTGTCCCTAGTGCTTGG - Intronic
999487741 5:152016200-152016222 AGTTCTGGGTCAATTTTAATTGG + Intergenic
1000442880 5:161283917-161283939 AGTTCTGGGTACATTGAGAGAGG - Intergenic
1000785332 5:165535765-165535787 AATTGTTGGTCCATAGTGAGAGG - Intergenic
1002791979 6:443746-443768 AGTCCTGGGTCCACAGTCCTGGG - Intergenic
1002938235 6:1692847-1692869 AGTTCTGGGTTGATTTTGATTGG + Intronic
1003458171 6:6303852-6303874 ATTTCTGGGTGCTTAGTGCTGGG + Intronic
1004048860 6:12053583-12053605 AGTTCTGAGTCCATAGCCCTAGG + Intronic
1006383527 6:33715570-33715592 AGTGCTGGGTCCACAGTGATTGG + Intergenic
1007213675 6:40219014-40219036 GATTCTGGGTCAATTGTGATTGG + Intergenic
1007764371 6:44152256-44152278 AGATCTGGGTCCCTAGCGCTAGG + Intronic
1010280306 6:74015593-74015615 AGTTCTGTGGCTACAGTGATTGG + Intergenic
1011967698 6:93179784-93179806 AGTTGTGGGTCCATAGTCCTAGG - Intergenic
1022355581 7:29611394-29611416 AGTGCTGGGTCCAGGGTGCTAGG - Intergenic
1025186086 7:56859825-56859847 AATTCTGAGGCCAAAGTGATAGG - Intergenic
1025685835 7:63717087-63717109 AATTCTGAGGCCAAAGTGATAGG + Intergenic
1031401512 7:121329821-121329843 AGTCCTGGGTCCTTAGGGGTTGG + Intronic
1031554590 7:123156911-123156933 AGTTCAGGGTCCATAAAGATGGG - Intronic
1035518493 8:256777-256799 AGTTCTAGTTTCATAGAGATGGG + Intergenic
1037597767 8:20368881-20368903 AGTTCTGGGATCATAGGGAAAGG - Intergenic
1041714964 8:60924279-60924301 AGTTCTGAGTGCCTAGGGATGGG + Intergenic
1043500359 8:80848300-80848322 AGTTCTGTGTCTACAATGATGGG + Intronic
1047193140 8:122696720-122696742 AGTGATGGGTCAAGAGTGATGGG - Intergenic
1049894319 9:99632-99654 AGTTTTGGGTCCATAGACAGGGG - Intergenic
1050315048 9:4392540-4392562 AGGTTTGGGGCCATAGTGAAAGG - Intergenic
1050612410 9:7366782-7366804 AAATCTTGGTCCATAGTGATGGG - Intergenic
1053451791 9:38199737-38199759 ACTTCTTGGGCCATGGTGATGGG - Intergenic
1053735549 9:41099736-41099758 AGTTTTGGGTCCATAGACAGGGG - Intergenic
1054692828 9:68331664-68331686 AGTTTTGGGTCCATAGACAGGGG + Intronic
1060810522 9:126609462-126609484 AGGTCTGGGTCTTTAGTCATGGG - Intergenic
1062048352 9:134434710-134434732 ATTTCTGAGTCCACAGTGCTGGG + Intronic
1186453605 X:9693216-9693238 AGTTCTGTGTCCCTCGTGCTGGG + Intronic
1188294200 X:28426559-28426581 AGTTTTGGTTCCAGATTGATTGG + Intergenic
1190435505 X:50420721-50420743 AGTTCTTGGCACATAGTGAGTGG - Intronic
1192395003 X:70771796-70771818 AAGTCTGGGTCCATAGTGGTGGG - Intronic
1196350015 X:114717858-114717880 AGTCCTGGGTACAAAGTAATTGG - Intronic
1199277030 X:145957065-145957087 ACTTCTGGGTACATATTTATTGG + Intergenic