ID: 916585133

View in Genome Browser
Species Human (GRCh38)
Location 1:166143639-166143661
Sequence ATGTGGAACCAGGAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 517}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916585121_916585133 21 Left 916585121 1:166143595-166143617 CCTACTCGGGCTGTGGTGCAGAG 0: 1
1: 0
2: 0
3: 9
4: 142
Right 916585133 1:166143639-166143661 ATGTGGAACCAGGAGGAAGAGGG 0: 1
1: 0
2: 3
3: 54
4: 517

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916585133 Original CRISPR ATGTGGAACCAGGAGGAAGA GGG Intronic
900742780 1:4340748-4340770 AGGTGGGACCTGGGGGAAGACGG + Intergenic
900763049 1:4485784-4485806 ATGTGGAACTGGGTGGAGGATGG - Intergenic
901616146 1:10541341-10541363 TTTTGGAACCTGGAGGAAGAAGG + Intronic
901781971 1:11600067-11600089 AGGAGGAGCCAGGAGGAAGCCGG - Intergenic
902713351 1:18255697-18255719 ATGGGGAAACAGTAGGAAGGGGG - Intronic
902859361 1:19233834-19233856 ATGAGGAACCAGAAGCAAAAAGG - Intronic
904884217 1:33724368-33724390 ATGGGGTCCCAGGAGGATGACGG - Intronic
905034170 1:34906545-34906567 ATTTGGAACCCGGAAGAGGAAGG - Intronic
905288974 1:36908375-36908397 AGGAGGACCCAGGAGGGAGAGGG - Intronic
906616285 1:47235026-47235048 ATGGGGAACCTGGAGGCTGAGGG + Intergenic
906741581 1:48190137-48190159 AGGAGGAAGCTGGAGGAAGAAGG + Intergenic
906918100 1:50033425-50033447 ATGTGGCACCAGCAGAAAAAGGG + Intergenic
907872246 1:58453948-58453970 ATGTGCAAGCAGGAGAAAGCAGG - Intronic
908651858 1:66342646-66342668 ACTTGAAACCAGGAGGTAGAGGG + Intronic
908892116 1:68860041-68860063 ATGCGGAACCAGAAGGGCGATGG + Intergenic
910002127 1:82353856-82353878 AAGTGGAAGCAGGAGAGAGAGGG + Intergenic
911355157 1:96808379-96808401 ATGAGGACACAGGGGGAAGATGG - Intronic
911901750 1:103514757-103514779 ATTTGGAACCAGCAGGTAAAAGG + Intergenic
912961923 1:114203601-114203623 ATGTGAAATAGGGAGGAAGAGGG + Intergenic
913107709 1:115629697-115629719 CTCTGGAACCAGAAGGAAAAGGG - Intergenic
913109789 1:115647675-115647697 AGGTGGAGCCTGGAGGAAGTGGG + Intronic
913207809 1:116557241-116557263 CTGTGGAACCTGGCTGAAGAAGG + Intronic
915823679 1:159053260-159053282 ATGTGGAAACAGGAAGAATTAGG + Intronic
915938559 1:160103623-160103645 CTAGGGAAACAGGAGGAAGAAGG - Intergenic
916039580 1:160950746-160950768 AGGAGGTACCAGGAGGCAGAAGG + Intronic
916585133 1:166143639-166143661 ATGTGGAACCAGGAGGAAGAGGG + Intronic
916622964 1:166521253-166521275 AGGTGCAAGCAGGAAGAAGATGG - Intergenic
916755956 1:167770561-167770583 ATAGGAAACCAGAAGGAAGAGGG + Intronic
916899660 1:169207183-169207205 GGGTGGAAGCAAGAGGAAGAAGG + Intronic
917509978 1:175661862-175661884 CTGTGGAGGCAGGAGAAAGAGGG - Intronic
918451675 1:184664766-184664788 ATCTGGAACGTGGAGGAAGAAGG - Intergenic
920567726 1:206988666-206988688 ATGTGGAAGAAGGAGGTAGAAGG + Intergenic
921564986 1:216706040-216706062 GTGGGGGACGAGGAGGAAGAGGG - Intronic
921935640 1:220793902-220793924 ATGTGGCAGGAGCAGGAAGAAGG + Intronic
921980808 1:221256818-221256840 TTGTGGAGCCAGAGGGAAGAGGG + Intergenic
922234911 1:223715404-223715426 ATGTTGAATCACCAGGAAGAAGG + Intronic
922814834 1:228441206-228441228 CTTTGAAACCAGGAGGGAGAAGG + Intergenic
922900677 1:229134171-229134193 AATTGGAACCAGGAGGTAGTGGG + Intergenic
922917454 1:229270669-229270691 ATGTGTAACAAGGAGGCAGTAGG - Intergenic
922990889 1:229910175-229910197 GTGTGGAAACAGCAAGAAGAAGG + Intergenic
923388893 1:233493897-233493919 ATGAGGAACTAGAAAGAAGATGG - Intergenic
923804966 1:237247710-237247732 TTGAGGTACCAGGAGGAAGGTGG + Intronic
924314786 1:242784597-242784619 TTGTGGGACTAGGAGGGAGATGG + Intergenic
924408160 1:243774264-243774286 ATGTGGAACTATGTGGAAAAGGG - Intronic
924802311 1:247336359-247336381 ATGTGAGAGCAGGAGGAAGAGGG + Intergenic
1063517211 10:6708771-6708793 ATCTGGAAACAGGAGCAAGAAGG - Intergenic
1064285801 10:13990343-13990365 ATGTGGGACAAGGAGGGAGGAGG + Intronic
1064322867 10:14321957-14321979 TGGTGGGAGCAGGAGGAAGAGGG - Intronic
1065097527 10:22296538-22296560 ATTTGGAACCAAGAGATAGAAGG + Intergenic
1065694287 10:28365661-28365683 AAGTGAAAAAAGGAGGAAGAAGG + Intergenic
1067211551 10:44263786-44263808 GTGTAGATACAGGAGGAAGATGG + Intergenic
1067717788 10:48703099-48703121 ATGTGAAACCATGGGGAAGAGGG + Intronic
1067945117 10:50684357-50684379 ACCTGGAAACAGAAGGAAGAAGG - Intergenic
1068690522 10:59909053-59909075 ATGTGCTGCCTGGAGGAAGAAGG + Intergenic
1068910913 10:62377065-62377087 TAGTTGAACCAGGAGGAACAAGG + Intronic
1069313222 10:67065515-67065537 CTGTGGGCCCAGGAAGAAGATGG - Intronic
1069409525 10:68139075-68139097 ATGTTGGAGCAGGAGGAAGAAGG - Intronic
1069700564 10:70421876-70421898 ATTTGGCACCCAGAGGAAGACGG - Exonic
1069960150 10:72074781-72074803 ACGTGAAAGCAAGAGGAAGAAGG - Intronic
1070039112 10:72757407-72757429 TTGGGGAAGTAGGAGGAAGAAGG - Intronic
1070866622 10:79711229-79711251 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1070880411 10:79849350-79849372 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1071633534 10:87233452-87233474 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1071646981 10:87365668-87365690 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1071730559 10:88244265-88244287 CTGAGGAACAAGGAGGAGGAGGG - Intergenic
1071815455 10:89227823-89227845 TGGTGGAGCCAGAAGGAAGAGGG + Intronic
1072181443 10:92985077-92985099 ATGGGGCAAAAGGAGGAAGAGGG - Intronic
1072313780 10:94182144-94182166 ATTTTGAAACAGGAGGAAAATGG + Intronic
1072782371 10:98259479-98259501 ATGAGGAACCAGGTGGCAGGGGG - Intronic
1073216694 10:101840418-101840440 ATTTGGAGCCAGGAGACAGAAGG - Intronic
1073371659 10:102995189-102995211 AAGAGGAAGGAGGAGGAAGAGGG - Intronic
1075186475 10:120263538-120263560 ATGTGGAAACATGAAGATGAAGG + Intergenic
1076021408 10:127076817-127076839 AAATGCCACCAGGAGGAAGAAGG - Intronic
1076204282 10:128582657-128582679 ATTTGCAACTAGCAGGAAGATGG - Intergenic
1076497662 10:130907536-130907558 GTGTGAAAACAGGAGGAAGCTGG - Intergenic
1077028978 11:455083-455105 ATGTGGGCTCAGGAAGAAGATGG - Intronic
1077554572 11:3219704-3219726 ATGTGGATCCTGGGGGAGGAGGG - Intergenic
1077867503 11:6234958-6234980 AGGTGGAACCAGAGGGCAGAAGG + Intronic
1078113927 11:8426178-8426200 ATGGGGAGCCAGAAGGGAGATGG + Intronic
1078155593 11:8797447-8797469 AAGGGGAAGAAGGAGGAAGAAGG - Intronic
1079182155 11:18203507-18203529 AAGTGGAAGGAGGAAGAAGAAGG + Intronic
1079438210 11:20479815-20479837 ATCTGGATCCAGGAGGGAAATGG - Intronic
1079487065 11:20946154-20946176 ATGTGGAACCACTGGGATGACGG + Intronic
1079986974 11:27209885-27209907 GTGTGTAAAGAGGAGGAAGATGG + Intergenic
1080666385 11:34339929-34339951 AGCTGGAACCAGCAGGAAGGAGG + Intronic
1082073538 11:47958755-47958777 AAGTGGGACCAAGAGGAGGATGG - Intergenic
1082262862 11:50090670-50090692 ATGTGGAAGAGGGAGGCAGAAGG + Intergenic
1083115623 11:60456576-60456598 ATGGGAAACCAAGAGTAAGAGGG + Intronic
1084062485 11:66685473-66685495 GTGAGGAACCAGAAGGCAGAAGG + Exonic
1084349652 11:68586849-68586871 ATGTGGAACCAAGGAGAAGGTGG + Intronic
1087335526 11:96839605-96839627 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1087727929 11:101743527-101743549 ATATGGAAACAGAAGGAAGAAGG + Intronic
1087800587 11:102499024-102499046 ATCTTGCACCAGCAGGAAGAAGG - Intergenic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1088340373 11:108758716-108758738 AAGTGGAAACAGGAGGCAGAAGG - Intronic
1088907593 11:114166242-114166264 GTGTGTAACCATGAGGGAGAGGG + Intronic
1088996148 11:114999042-114999064 ATGCAGAGCCAGGAGGAGGAAGG + Intergenic
1089690293 11:120182902-120182924 ATGTGGCAGGAGGAGGGAGAAGG + Intronic
1089756431 11:120690910-120690932 ATGTGGAACCTAGAGAACGAGGG - Intronic
1090749997 11:129738163-129738185 ATCTGGAAGGAGCAGGAAGAAGG - Intergenic
1091074183 11:132599367-132599389 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091074185 11:132599377-132599399 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091074187 11:132599387-132599409 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091074189 11:132599397-132599419 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091074191 11:132599407-132599429 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091440927 12:511469-511491 AGGTGGAAGAAGGTGGAAGAAGG - Intronic
1091441006 12:511799-511821 AGGTGGAAGAAGGTGGAAGAAGG - Intronic
1091441114 12:512246-512268 AGGTGGAAGAAGGTGGAAGAAGG - Intronic
1091441116 12:512256-512278 AGGTGGAAGAAGGTGGAAGAAGG - Intronic
1091527026 12:1313136-1313158 TTTTGCAAGCAGGAGGAAGAAGG - Intronic
1091553348 12:1553630-1553652 CTGTGGCCCCAGGAGGAAGCTGG + Intronic
1092164142 12:6332592-6332614 CTGTGGAGCCAGGAGTAAGGAGG + Intronic
1092236876 12:6815965-6815987 ATGTGGAGGCAGCAGGGAGATGG - Intronic
1092495981 12:8995562-8995584 ATGTGGGGCAAGGAGGCAGAAGG + Intronic
1092550217 12:9490302-9490324 AGGTGGAAGGAGAAGGAAGAAGG + Intergenic
1092839574 12:12526929-12526951 ATGGGGCTCCAGGAGGAAGCGGG + Intronic
1093423768 12:19004432-19004454 AAGTGGAACTAGGGCGAAGAGGG - Intergenic
1093508397 12:19896755-19896777 AGGAGGAAGAAGGAGGAAGAAGG - Intergenic
1093508399 12:19896765-19896787 AGGAGGAAGGAGGAGGAAGAAGG - Intergenic
1093572241 12:20679812-20679834 ATGGGGAAAAAAGAGGAAGATGG - Intronic
1093752463 12:22816674-22816696 GGATGGAACCAGGAGAAAGAAGG + Intergenic
1094070216 12:26404545-26404567 ATCAGGAAACAGTAGGAAGAAGG + Intronic
1094180713 12:27590256-27590278 ATTTGGACCCAGGAGGCAGAGGG - Intronic
1094361734 12:29638400-29638422 ATGGGGATCCAGAAGGGAGATGG - Intronic
1094521591 12:31196071-31196093 AGGTGGAAGGAGAAGGAAGAAGG - Intergenic
1095100374 12:38175819-38175841 CTGGGGAACTAGGAGGAAGAAGG - Intergenic
1095782265 12:46072908-46072930 ATGTGGAATCCAGAGGAAGATGG + Intergenic
1096059551 12:48685086-48685108 ATTTGAACCCAGGAGGCAGAGGG + Intergenic
1096405618 12:51342120-51342142 ACTTGAACCCAGGAGGAAGAGGG - Intronic
1096596063 12:52696319-52696341 CTGTGGACCCAGGAGGCTGAGGG - Intronic
1096807573 12:54149911-54149933 ATGTGGAATCAGGAGGCCGAGGG - Intergenic
1097044574 12:56177973-56177995 ATGTGGGGACAGGAGGGAGAAGG + Intronic
1097958094 12:65506685-65506707 AGGGAGAACTAGGAGGAAGATGG + Intergenic
1098079180 12:66765859-66765881 ATGGGGAGACAGGAAGAAGATGG + Intronic
1098521274 12:71437524-71437546 ATGAGGAAGCAGGAGAGAGAGGG + Intronic
1099136462 12:78909982-78910004 ATGTGAACAGAGGAGGAAGAAGG - Intronic
1099865063 12:88269657-88269679 ATTTGGAACCAGAAGGAAAAGGG + Intergenic
1099949412 12:89283992-89284014 ATTTGAACCCAGGAGGCAGAGGG + Intergenic
1100406449 12:94276463-94276485 AGGTGGAACCAGAAGGAGGGAGG + Intronic
1100442745 12:94631477-94631499 ATGTGAAGACAGGAGAAAGACGG + Intronic
1101781628 12:107843627-107843649 GTTTGGCTCCAGGAGGAAGAAGG - Intergenic
1102152759 12:110699957-110699979 CTCTTGGACCAGGAGGAAGAAGG - Intronic
1102230367 12:111257636-111257658 AGGAGGAAGGAGGAGGAAGAGGG - Intronic
1102751139 12:115295784-115295806 ATGAGAGACCAAGAGGAAGAGGG - Intergenic
1102894067 12:116584542-116584564 AGGGGGAAGCAGGAGCAAGAAGG - Intergenic
1103157869 12:118702317-118702339 ACGTGGAAGAAAGAGGAAGAAGG + Intergenic
1104238305 12:126961237-126961259 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1105345979 13:19573102-19573124 ATGTGGAACAGGGATGAACACGG + Intergenic
1105537910 13:21287385-21287407 AGTTGGAATCAGGAGAAAGAGGG + Intergenic
1105826210 13:24125773-24125795 AAAAGGAACCAGGAGGCAGAAGG + Intronic
1106343454 13:28853333-28853355 ATATGTAACCAGTAGGAACATGG - Intronic
1106619548 13:31360357-31360379 TTGTGGAACAAGGAGTCAGAGGG + Intergenic
1106766823 13:32921871-32921893 GGGAGGAAGCAGGAGGAAGAGGG + Intergenic
1107169819 13:37327501-37327523 ATGTGGAATATGGGGGAAGATGG + Intergenic
1107421005 13:40246385-40246407 AAGAGGAATCAGGAGGAAGGAGG - Intergenic
1107958822 13:45541829-45541851 ATTTGGAAGCAGCAGGAAGGTGG - Intronic
1109326952 13:60879216-60879238 AGGTGGATCCAGGAAGGAGAAGG + Intergenic
1110227854 13:73138782-73138804 AATCGGAACCAGGAGGAAGGAGG - Intergenic
1110334433 13:74310515-74310537 ATGTGGTGTCAGGAGGGAGAAGG + Intergenic
1111184859 13:84720422-84720444 ATGGGGAGCCAGGAGGGAGATGG - Intergenic
1111601865 13:90484132-90484154 ATGGAGAACCAAGAGGAACATGG + Intergenic
1111995497 13:95162209-95162231 ATGTGGAAACTAAAGGAAGAAGG - Intronic
1114584432 14:23797149-23797171 ATGAGGTACCCTGAGGAAGAGGG + Intergenic
1115140679 14:30167979-30168001 TGGTGAAAGCAGGAGGAAGAAGG + Intronic
1115316448 14:32029724-32029746 ATGTGCAACCTGGAAGTAGAAGG - Intergenic
1115620859 14:35138871-35138893 ATGTGAACCCAGGAGACAGAGGG - Intronic
1115979138 14:39030262-39030284 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1117682455 14:58218674-58218696 ATGTAGATCCAGGTGGAAGAAGG + Intronic
1119653510 14:76400135-76400157 ATGAGGTACCAGGAGCAGGAGGG - Intronic
1120957363 14:90094592-90094614 ATTTGGCACCTGGAGGATGATGG + Intronic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1121001872 14:90456839-90456861 ATGTGGAGTGGGGAGGAAGAGGG + Intergenic
1121537259 14:94699376-94699398 ATTTGGGAGCAGGAGGAAGCAGG + Intergenic
1123720463 15:23056421-23056443 AGGTGGAACCAGGTGGTAAATGG - Intergenic
1124626350 15:31309601-31309623 GTGCGGTAACAGGAGGAAGACGG - Intergenic
1125301432 15:38257742-38257764 ATGTGGAACCATGGGGGAAAGGG - Intronic
1126403315 15:48296647-48296669 ATGAGGAACAAGGATGAGGAAGG + Intronic
1126697668 15:51340026-51340048 TGGTGGGAGCAGGAGGAAGAGGG + Intergenic
1127055065 15:55122863-55122885 ACTTGGACCCAGGAGGCAGAGGG + Intergenic
1127649742 15:60995413-60995435 ATGTGGAGCCAGGAAATAGAAGG - Intronic
1128095821 15:64954599-64954621 AAGAGGAAGGAGGAGGAAGAAGG - Intronic
1128341409 15:66825039-66825061 ATCTTGAACAAGAAGGAAGAAGG + Intergenic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128997755 15:72309428-72309450 ATGTGGACCCGGGAAGAGGAGGG + Intronic
1129108329 15:73323517-73323539 ATGTGGAAGGAGGATGAAGACGG + Exonic
1129769780 15:78195674-78195696 ATTTGGAAAAAAGAGGAAGAAGG - Intronic
1130920035 15:88336058-88336080 ATGTGGACGCATGAGGATGAGGG + Intergenic
1131066390 15:89437263-89437285 AGGTAGAAGAAGGAGGAAGAGGG - Intergenic
1131565874 15:93484983-93485005 GTGTTGAACTAGGAGTAAGAAGG - Intergenic
1132389039 15:101425331-101425353 AGGGAGAACCAGGAGGAAGCGGG - Intronic
1133605579 16:7384580-7384602 ATGGGGAAATAGGAGGGAGAGGG + Intronic
1133971598 16:10572085-10572107 ATGAGGGAGCAGGAGAAAGAGGG + Intronic
1134254231 16:12598574-12598596 ACTTGAAACCAGGAGGTAGAGGG - Intergenic
1134507561 16:14820708-14820730 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134695259 16:16219470-16219492 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134976573 16:18575216-18575238 ATGTGGAAACAGGAGGAGAAAGG - Intergenic
1135401292 16:22167988-22168010 ATTTGGAATCAGGAGTAGGAGGG + Intronic
1137018390 16:35397988-35398010 ATGTGGAATCAGAATGAAGCAGG - Intergenic
1138146249 16:54614818-54614840 TGGTGGAAGCAGGAGCAAGAAGG - Intergenic
1138773026 16:59687513-59687535 ATGGTGGAGCAGGAGGAAGAGGG + Intergenic
1140031388 16:71341988-71342010 ACATGGAATCTGGAGGAAGAAGG + Intergenic
1141690437 16:85593534-85593556 ACGTGGAAGCAGGAAGGAGAAGG - Intergenic
1141719828 16:85750190-85750212 CTTTGGAGCCCGGAGGAAGAGGG - Intronic
1143036779 17:4004074-4004096 CTGCGGAACCCGGAGGAGGAAGG - Intergenic
1143095524 17:4476592-4476614 ATGTGGCCCCAGGAGGCAGCTGG + Intronic
1143443773 17:6995705-6995727 CTGGGGAGCCAGGAGGAAGTAGG - Intronic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143579998 17:7819885-7819907 ATGAGGACCCTGAAGGAAGAGGG - Intronic
1143794687 17:9327206-9327228 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1144038951 17:11391429-11391451 AAGTGTAACAAGGAGGAAGAGGG - Intronic
1147178563 17:38671554-38671576 TTGTGGGAGGAGGAGGAAGAAGG - Intergenic
1147964394 17:44186440-44186462 GTGTGGGACCCGGAGAAAGAAGG - Intergenic
1148127091 17:45242490-45242512 ATGTGGGCACCGGAGGAAGAGGG + Intronic
1148438998 17:47702210-47702232 AGGTGGAAACAGAAGAAAGAGGG - Intronic
1149399910 17:56285452-56285474 AAGTGGAATAAGGAGGAAAAAGG - Intronic
1149928684 17:60727645-60727667 ATGTGGAGGCAGGAGGTATACGG - Intronic
1150009129 17:61488348-61488370 ACGCAGAACCAGGAGGAAAAGGG + Intergenic
1150679041 17:67269684-67269706 CTCTGGAACCCGGAGGGAGAAGG - Intergenic
1151151989 17:72096048-72096070 AGCTGGAACCTGGAGGATGAGGG - Intergenic
1151733031 17:75922146-75922168 TGGTGGAAGCAGGAGGAAGGGGG - Intronic
1152162765 17:78679309-78679331 ATGAAGCACCAGGAGGGAGAGGG + Intronic
1152224903 17:79088219-79088241 ATTTGGAACCAGGGGGAACCAGG + Intronic
1152657693 17:81527606-81527628 ATGTGGATCCAGGAGGCTGGTGG - Intergenic
1153063482 18:1018605-1018627 ATCTGGAACCAGGTGGATGACGG - Intergenic
1153452945 18:5249753-5249775 ATCTTGAACCATGAGGATGAAGG + Intergenic
1153638048 18:7129904-7129926 ATGTGGAGCGAGAATGAAGAAGG + Intergenic
1154978837 18:21485608-21485630 ATTTTGAACCAGGAGGACGTGGG + Exonic
1155529992 18:26757379-26757401 TTGTTGAACCAGGAAGAGGAAGG + Intergenic
1156671760 18:39479222-39479244 AAGGGGAAACAGGAGAAAGAAGG + Intergenic
1156811103 18:41252800-41252822 ATGTGTAATGAGAAGGAAGAAGG + Intergenic
1157382017 18:47227145-47227167 AGGAGGAAGAAGGAGGAAGATGG - Intronic
1158737391 18:60098789-60098811 AAGAGGAAGGAGGAGGAAGAAGG - Intergenic
1159312078 18:66722339-66722361 ATGTGGAGACATGAGGGAGATGG - Intergenic
1160556875 18:79731133-79731155 ATGTGTCCCCAGGATGAAGAGGG - Intronic
1160667888 19:341710-341732 AAGTGGAAGCAGGAAAAAGAGGG + Intronic
1162467747 19:10852691-10852713 ATGGTGAACAAGGAGGAAAATGG + Intronic
1162844725 19:13383366-13383388 ATGGGGAAGATGGAGGAAGAAGG + Intronic
1163044726 19:14631870-14631892 AAGTGGAAGTAGCAGGAAGAGGG + Intronic
1165433665 19:35785523-35785545 ATGTGGAGCCGGGAGGAATTGGG + Intronic
1165468769 19:35990826-35990848 AGGAGGAAGAAGGAGGAAGAAGG + Intergenic
1165468771 19:35990836-35990858 AGGAGGAAGAAGGAGGAAGAAGG + Intergenic
1165468773 19:35990846-35990868 AGGAGGAAGAAGGAGGAAGAAGG + Intergenic
1165468775 19:35990856-35990878 AGGAGGAAGAAGGAGGAAGAAGG + Intergenic
1168294264 19:55370879-55370901 AGGTGGAGGCAGGAGGAAGAGGG + Intergenic
925580536 2:5406018-5406040 ATAAGGAAGCAGGAGGAATAGGG + Intergenic
925702126 2:6649227-6649249 ATGAAGAATGAGGAGGAAGAAGG - Intergenic
925712891 2:6758669-6758691 ATGTGGAAGAGGGAGGCAGAGGG + Intergenic
925752427 2:7101034-7101056 AGGAGGAGACAGGAGGAAGAGGG - Intergenic
927391461 2:22600133-22600155 CTGTGGAACTAGGAGGTGGAGGG + Intergenic
928013091 2:27629040-27629062 GGGTGGGGCCAGGAGGAAGATGG + Exonic
928676441 2:33655842-33655864 AGGAGGAAACAGGAAGAAGAAGG - Intergenic
928819341 2:35342186-35342208 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
928855006 2:35792644-35792666 GTGTGGAAACTGGAGGAACATGG + Intergenic
929818741 2:45257082-45257104 CTGTGGAAGCGGGAGGAACATGG + Intergenic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
931219348 2:60275176-60275198 ATGTTGGACCATGAGGATGAGGG + Intergenic
931253111 2:60550723-60550745 AGATGGACCCAGGAGGGAGAGGG + Intronic
932452756 2:71825414-71825436 AAGTGCAAACAGGAGAAAGAAGG + Intergenic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
935652023 2:105390492-105390514 ATGAGGAACAAGGTAGAAGAGGG - Intronic
936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG + Intronic
936922195 2:117700215-117700237 ATGTGGAAGAAGGAGGTAGAAGG + Intergenic
937419339 2:121741249-121741271 ATGAGAGACCAGGAGGGAGAGGG + Intronic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
937862878 2:126724852-126724874 GTGTTTAACCAGAAGGAAGAGGG - Intergenic
937962109 2:127468033-127468055 ATGTGAAACCAGGAAGAACCAGG + Intronic
938605898 2:132892247-132892269 ATCTGGAAGCAGAAGTAAGAAGG - Intronic
939366939 2:141245908-141245930 TTGTGGAAAAAAGAGGAAGAAGG - Intronic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
942142159 2:172988195-172988217 GTGTTTAACCAGGGGGAAGAAGG + Exonic
942332335 2:174840072-174840094 ATATTGAACCATGAGGAATATGG + Intronic
942709341 2:178815007-178815029 ATGTGGAGACAGGAGGAAGATGG + Intronic
943218704 2:185075782-185075804 ATGTAGAATGAGGAGGAGGAGGG + Intergenic
943416323 2:187610562-187610584 AAGTGGATCCAGGGGGCAGAGGG - Intergenic
944237381 2:197452905-197452927 ATGTGGGACACGCAGGAAGAAGG + Intergenic
944770809 2:202912475-202912497 AGGAGGAGGCAGGAGGAAGACGG - Intronic
944848184 2:203690155-203690177 AGGTGGCAGCAGGAGGCAGAGGG - Intergenic
945288126 2:208102724-208102746 ATTTGGATCCAGGACCAAGATGG - Intergenic
946056768 2:216909778-216909800 ATGGGGAAACAGAAGGGAGATGG - Intergenic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
947072458 2:226305655-226305677 ATGTGTAACAAGAAAGAAGAGGG + Intergenic
947142835 2:227035212-227035234 ATATGGAACAAGGTGGATGAGGG + Intronic
948061276 2:235044767-235044789 ATGTTGAGCCAGGAGACAGAAGG + Intronic
948189607 2:236047431-236047453 AGGTGGCACGAGAAGGAAGAGGG - Intronic
948432275 2:237927420-237927442 AGGTGGCACCAGGAAGATGATGG + Intergenic
948768683 2:240236365-240236387 AGGTGCAAACAGGAGGACGATGG - Intergenic
1168850005 20:969972-969994 ATGGGGCACCAATAGGAAGAGGG - Intronic
1168886524 20:1263234-1263256 ATCTGGGACCAGGAGGTAGGAGG + Intronic
1170136106 20:13075288-13075310 ATGTGTCACTAGGAGGGAGAAGG - Intronic
1170910292 20:20559711-20559733 ATGAGGAAATAGGAGGAGGAGGG + Intronic
1171417955 20:24996220-24996242 GTGAGGCACCAGGAGGCAGAGGG - Intergenic
1171796204 20:29568226-29568248 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1171820387 20:29831223-29831245 ATGGAGAACCACGAGAAAGAAGG + Intergenic
1171822667 20:29868392-29868414 ATGGAGAATCAGGAGAAAGAAGG + Intergenic
1171852032 20:30315941-30315963 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1171897454 20:30821921-30821943 AAGGAGAACCAGGAGAAAGAAGG - Intergenic
1172060702 20:32185413-32185435 ATGTGAAAGGAGGTGGAAGAAGG + Intergenic
1172979187 20:38928040-38928062 CTGGGGATCAAGGAGGAAGAAGG + Intronic
1173302442 20:41816228-41816250 ATGTGGAAGCAGAAGGCAGAAGG - Intergenic
1173619514 20:44426067-44426089 CTGTGGAATCAGGGGGAAGATGG + Intronic
1173781017 20:45757472-45757494 ATTTGAACCCAGGAGGCAGAGGG + Intronic
1173876325 20:46374494-46374516 ATGTGGCACCAGGACTGAGAAGG + Intronic
1174157101 20:48522732-48522754 AAGTGGAACCAGCAGGAATGAGG - Intergenic
1174901511 20:54505746-54505768 ATGTGGACACATGAAGAAGAGGG + Intronic
1174952213 20:55054634-55054656 ATTTGGAGGCAGGAGGGAGAAGG - Intergenic
1175054413 20:56185213-56185235 TTGTGGGAACAGGAGCAAGAAGG - Intergenic
1175503321 20:59465496-59465518 ATGGGGCAGAAGGAGGAAGAAGG - Intergenic
1175774147 20:61642307-61642329 ATGGGGAACCAGCAGGTGGATGG + Intronic
1176225063 20:63992814-63992836 ATTTGAACCCAGGAGGCAGAGGG - Intronic
1177048484 21:16201543-16201565 TTGTGCAACCAGGTGGATGATGG - Intergenic
1178077419 21:29024695-29024717 ATTCGTCACCAGGAGGAAGACGG + Exonic
1179024855 21:37671430-37671452 ATGAGCAGCCAGAAGGAAGAAGG - Intronic
1179166092 21:38936376-38936398 ATGTGCTTCCAGTAGGAAGAGGG - Intergenic
1179573895 21:42294799-42294821 AGGTGGAACTAGCAGGAAGATGG - Intronic
1180116352 21:45708112-45708134 ATGTGGAACCCCTAGGAAGGAGG - Intronic
1180143226 21:45905663-45905685 GTGAGGACCCAGGAAGAAGACGG - Intronic
1180174159 21:46079404-46079426 ATGTTGGACCAGGAGGGAGCCGG - Intergenic
1180393977 22:12312526-12312548 AGGTGTAAGCAGGAGGCAGAAGG - Intergenic
1180405770 22:12552224-12552246 AGGTGTAAGCAGGAGGCAGAAGG + Intergenic
1180743905 22:18073839-18073861 ATGTGGAACCAGTGTGGAGAAGG + Intergenic
1181037382 22:20176426-20176448 ATGTGGAGGGAGAAGGAAGAAGG - Intergenic
1181087581 22:20449141-20449163 GTGTGAACCCAGGAGGCAGAGGG - Intronic
1181618004 22:24068188-24068210 TTGGGGAAGCAGGAGGGAGAAGG + Intronic
1182070822 22:27462524-27462546 ACCAGGAACCAGGAGGAACAGGG - Intergenic
1182139357 22:27939365-27939387 ATTTGAACCCAGGAGGCAGAGGG + Intergenic
1182175049 22:28276429-28276451 ATGTGGATTCAGGAGAAAGATGG + Intronic
1182711994 22:32328982-32329004 AAGAGGAAGCAGGAGGCAGAGGG - Intergenic
1183580563 22:38723639-38723661 ATTTGGAACCAGAAGGAACAAGG - Intronic
1183597598 22:38822028-38822050 AGGAGGAAAGAGGAGGAAGAGGG + Exonic
1183733132 22:39629388-39629410 ATATGGATGTAGGAGGAAGAGGG - Intronic
1184399538 22:44265866-44265888 AAGAGGAAGCAGGAGGCAGAGGG - Intronic
1184934172 22:47706934-47706956 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1185180351 22:49356690-49356712 GCATGGAAACAGGAGGAAGATGG - Intergenic
949808031 3:7976732-7976754 ATGTGGAGCCAGAAGGGGGATGG - Intergenic
950550016 3:13660599-13660621 AGGTGGAGCCAGGAGCTAGAAGG - Intergenic
952386378 3:32844292-32844314 ATGTTGCCCTAGGAGGAAGAGGG + Intronic
953193706 3:40712834-40712856 AGATGGATCCAGGAGGAAGAAGG + Intergenic
954764208 3:52899009-52899031 ATGTGGGAGCAAGAGGGAGAGGG - Intergenic
955625866 3:60918619-60918641 AAAGGAAACCAGGAGGAAGAAGG + Intronic
955825665 3:62944413-62944435 ATTTGAAACTAGGAGGAAGGTGG + Intergenic
956575523 3:70748549-70748571 GTGGGGAAACAAGAGGAAGAGGG - Intergenic
958795374 3:98701516-98701538 GTGTGGAAAAGGGAGGAAGAAGG + Intergenic
959117776 3:102197793-102197815 ACCTGGAACCAGGTGGAAGCTGG - Intronic
959665603 3:108917569-108917591 ATGTGGGAGCAGGAGGACGCAGG + Intronic
960143187 3:114171303-114171325 ATGTGAGGCCAGGAGGAAAAAGG - Intronic
960354734 3:116637289-116637311 ATTTGTCACCATGAGGAAGAAGG + Intronic
960361850 3:116722226-116722248 AGGAGGAAAGAGGAGGAAGAAGG + Intronic
963035198 3:141019706-141019728 ATGTCCAAAAAGGAGGAAGAAGG - Intergenic
963271166 3:143287080-143287102 AAGTGGGACCAGAAGGAAGGAGG - Intronic
964148669 3:153497577-153497599 ATGTGGTACCATGTAGAAGATGG - Intronic
964560997 3:157996520-157996542 AAGTGGAAGCAGAAGGCAGAAGG + Intergenic
964718939 3:159752604-159752626 TGGTGGAAGCAGGAGCAAGAGGG + Intronic
965067130 3:163864339-163864361 ATGGGGATCCAGGAGGATGAGGG - Intergenic
965780564 3:172281489-172281511 AGGTGGAATCAGGTGGAAAATGG + Intronic
965836843 3:172862374-172862396 TGGTGGAAGCAGGAGGAAGCGGG - Intergenic
966486588 3:180477947-180477969 ATGTGGAATCAGAAGGAAAAAGG - Intergenic
967069215 3:185947343-185947365 ATGGGGAAACTTGAGGAAGAAGG + Intergenic
967842648 3:194019216-194019238 AAGTGTAACCAGGAGGGTGATGG - Intergenic
968217294 3:196904222-196904244 ATAGGGTAGCAGGAGGAAGATGG + Intronic
968900700 4:3430501-3430523 CTGTGGAACCAGGAGGTAAACGG - Exonic
969065298 4:4474638-4474660 ATGTGGAAGTGGGAGGCAGAAGG + Intronic
969200965 4:5605620-5605642 ATGTTGAAGCAAGAGAAAGAAGG + Intronic
969208319 4:5665551-5665573 ATAGCGAACCATGAGGAAGAGGG + Exonic
969250862 4:5967885-5967907 ATGCGGAACCAGGAGGACACTGG - Intronic
970234437 4:13944477-13944499 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
970856025 4:20650380-20650402 ACGTGGCAGCAGGAAGAAGAGGG + Intergenic
972229520 4:37054979-37055001 ATCGGGATCCAGGAGAAAGAAGG - Intergenic
973725489 4:53771616-53771638 ATGTGGAAACTGGAGAAAAAGGG + Intronic
973808432 4:54547626-54547648 AGGTGGAAGCAGAAGGCAGAAGG - Intergenic
974411241 4:61543317-61543339 AAGTGGAAGCAGGAGGCAAAGGG + Intronic
975084498 4:70321414-70321436 ATGTGAAACCAGAAGGAGAAAGG - Intergenic
975373362 4:73613546-73613568 ATCTGGACCCAGGAGGAAGAAGG - Intronic
975470198 4:74757085-74757107 CTGTGGAGCCAGGAGGACCATGG + Intronic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975937209 4:79596468-79596490 AGGTGGAACCTGGAGTAGGAAGG - Intergenic
976825649 4:89257637-89257659 ATGTGGACTCAGGAGCCAGATGG - Intronic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978420171 4:108523915-108523937 ATGAGGAATCAGCAAGAAGATGG - Intergenic
979194899 4:117909160-117909182 ATGTGGAGCCAGGGAGAAGGAGG - Intergenic
979280819 4:118865688-118865710 CTTTGGAAACAGGAGGAAGGAGG + Intronic
979472648 4:121118809-121118831 GTCTGGAAGTAGGAGGAAGAGGG - Intergenic
982212906 4:153055319-153055341 ATCTGGCCGCAGGAGGAAGAGGG + Intergenic
982420040 4:155184005-155184027 AAGCGGAGACAGGAGGAAGAAGG - Intergenic
982786427 4:159542595-159542617 ATGTTGAAGCATGAGGAAAATGG + Intergenic
983850109 4:172569956-172569978 ATATAGTACCAGGAGGAAGGAGG + Intronic
984455163 4:179957370-179957392 ATGAGGAACCTGAGGGAAGAGGG + Intergenic
984573963 4:181425948-181425970 ATGGGGAGCCAGGAAGACGAAGG + Intergenic
984937914 4:184905543-184905565 ATGTGGAATAAGGATGAGGATGG - Intergenic
985631334 5:1015620-1015642 ATCAGGAAGCAGGAGGAAGCAGG + Intronic
987052696 5:14161340-14161362 AAGGGAAACCAGGAAGAAGAGGG - Intronic
987589477 5:19904823-19904845 TTGTGGGAACAGGAGGAGGAAGG + Intronic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
987866691 5:23549920-23549942 ATGATCAACCATGAGGAAGAGGG - Intergenic
988474517 5:31572084-31572106 ATGAGCAAACAGGAAGAAGAGGG + Intergenic
989193739 5:38695674-38695696 ATGGGGAAAGAGGAGGAAGAAGG - Intergenic
989826881 5:45867183-45867205 AAGTTGAACAAGGAGGAAAATGG - Intergenic
990325466 5:54671062-54671084 GTGTGAATCCAGGAGGAACATGG + Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990585541 5:57207714-57207736 ATGGGAAGCCAGGAGGGAGATGG + Intronic
991386940 5:66101124-66101146 TTGTGTAACCAGGAGTATGATGG - Intergenic
991557542 5:67912517-67912539 ATGGTCAATCAGGAGGAAGAAGG + Intergenic
992376186 5:76190044-76190066 TGGTGGAAGCAGAAGGAAGATGG + Intronic
992868530 5:80982429-80982451 ATGTTTAACCTGTAGGAAGAAGG + Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
995538688 5:113163115-113163137 ATGAGGACCCATGAGGCAGAGGG - Intronic
996330924 5:122327902-122327924 ATGTGAAATGGGGAGGAAGATGG + Intronic
996960691 5:129245324-129245346 ATGTGGAGCAAGTAGAAAGAGGG + Intergenic
997598099 5:135120633-135120655 AGGTGGGGCCAGGAGAAAGATGG + Intronic
998090238 5:139362301-139362323 ACTTGAAACCAGGAGGCAGAGGG - Intronic
998440503 5:142157383-142157405 ATGTGGAATCAGGAAGCAGATGG - Intergenic
998679883 5:144455236-144455258 ATGTGGAAGCAGAAGGAAGTTGG - Intronic
999009281 5:148017297-148017319 ATGTGAACCCGGGAGGCAGAGGG - Intergenic
999835255 5:155363553-155363575 ATGGGGAAGGAGGAGAAAGATGG - Intergenic
1000216596 5:159163460-159163482 AAGTGGAAACAGTGGGAAGAGGG - Intronic
1000368386 5:160511725-160511747 ATGTGGAACCAGGAACAAAGAGG + Intergenic
1001132903 5:169079536-169079558 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1001738155 5:174023850-174023872 GTGTGGTTCCAGGATGAAGAAGG - Intergenic
1002108416 5:176891740-176891762 ATGGGGCAGGAGGAGGAAGAAGG - Intronic
1002118227 5:176981703-176981725 AGGTGGGACCAGGAGAAGGAAGG + Intronic
1002224045 5:177705340-177705362 TGGTGAAACCAGAAGGAAGAGGG - Intergenic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1003099530 6:3166509-3166531 ATGTGAAAGGAGGAGGTAGAAGG - Intergenic
1003173456 6:3737865-3737887 AGGTGTAATCAGGAGAAAGAAGG - Intronic
1003285667 6:4731889-4731911 CTGTGGAAGGAGGGGGAAGATGG + Intronic
1003286799 6:4741504-4741526 ATCTGGAACTATGAGGATGAGGG - Intronic
1003978946 6:11371173-11371195 ATGTGGGAGCAGGAGGTATATGG - Intronic
1005771558 6:29078018-29078040 ATGTGGAACTAGGATTATGATGG - Intergenic
1007107738 6:39295235-39295257 ATGGGGAAGCAGGGGGCAGAGGG + Intergenic
1007848797 6:44783386-44783408 CTTTGGAACCAGGAGGTAAATGG + Intergenic
1007978869 6:46130090-46130112 AAGGGGGACCTGGAGGAAGAGGG - Exonic
1008064981 6:47037941-47037963 ACTTGAACCCAGGAGGAAGAGGG - Intronic
1008420322 6:51291701-51291723 ATGTGGAGACAGGAGGGGGATGG + Intergenic
1009352408 6:62697295-62697317 ATATGGAAACAAGAGTAAGATGG + Intergenic
1009413051 6:63388546-63388568 ATGTGAAGCCAGGGAGAAGACGG + Intergenic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010122885 6:72399515-72399537 ATGGGGTACAAAGAGGAAGAGGG + Intronic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1010758441 6:79694291-79694313 ACGTGGTAAGAGGAGGAAGAGGG - Intronic
1012449493 6:99339847-99339869 ATAGGGAACAAGGAAGAAGAGGG + Intronic
1012639012 6:101585695-101585717 AATTGGAACCAGGTGGAAAAAGG + Intronic
1012665237 6:101961070-101961092 ATGTGGAACTGGGAGAAACATGG - Intronic
1012666930 6:101982939-101982961 ATTTGGAAAAAGGAGGAACAGGG + Intronic
1013252769 6:108350780-108350802 AGGTGAAACCAGGAGGCAGCAGG - Intronic
1013740313 6:113276067-113276089 ATGTGGCTACATGAGGAAGACGG + Intergenic
1015396120 6:132736924-132736946 AAATGGAACCAAGAGAAAGAAGG - Intergenic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1019869267 7:3743702-3743724 ATGTCGGAGGAGGAGGAAGAGGG + Intronic
1019975284 7:4576331-4576353 ATCTGAACCCAGGAGGCAGAGGG + Intergenic
1021515615 7:21481328-21481350 GTGTGGAAACGGGAGGAAGTAGG + Intronic
1021623640 7:22571992-22572014 ATGTGGGCCCAGGAGGAAGAAGG + Intronic
1021843763 7:24744602-24744624 ATTTGGAACCCTGAGGAAGCAGG - Exonic
1022209659 7:28195962-28195984 ATGTGGCCCCAGGAGGGAGGAGG - Intergenic
1022535351 7:31095252-31095274 ACGTGAATCCAGGAGGAAGGAGG + Intronic
1023609197 7:41956985-41957007 AAGGGAAACCAGGAGCAAGAGGG + Intergenic
1023896054 7:44433898-44433920 TTGTGGGAGCAGGAGGAAAAAGG - Intronic
1025192257 7:56904886-56904908 ATGTGGACCGAGGAGGATAAAGG - Intergenic
1025679691 7:63672046-63672068 ATGTGGACCGAGGAGGATAAAGG + Intergenic
1025910589 7:65825438-65825460 ATGTGGAAGAGGGAGGCAGAAGG - Intergenic
1026044765 7:66899383-66899405 ATGTGGAAGAGGGAGGCAGAAGG - Intergenic
1026250391 7:68664938-68664960 ATGTTGATCTATGAGGAAGAAGG + Intergenic
1026464782 7:70644745-70644767 TTCTGGAATGAGGAGGAAGAGGG - Intronic
1026820712 7:73546175-73546197 ATGTGTAACTACGAGGAGGACGG - Intronic
1027424467 7:78048430-78048452 GTGAGGAACAACGAGGAAGAAGG - Intronic
1027942450 7:84701553-84701575 ATGTAGACCAAGGAAGAAGACGG + Intergenic
1027957600 7:84900971-84900993 ATGTGGAAGGAGGGGAAAGAGGG + Intergenic
1028377946 7:90167125-90167147 ATGAGGAACAAGGGGGAGGAAGG + Intergenic
1029669443 7:102019131-102019153 ATGTGGACCGAGGAGGATAAAGG - Intronic
1032122816 7:129169163-129169185 ACGGGGAATGAGGAGGAAGAAGG + Intronic
1032400682 7:131622347-131622369 ATGAGGACCCAGGAGGGAGCGGG - Intergenic
1032639186 7:133746799-133746821 ATGAGGAATCACGAGAAAGATGG - Intronic
1032794660 7:135268190-135268212 CAGTGGACCCAGGAGGAAGGAGG - Intergenic
1033118866 7:138649374-138649396 ATTTGAACCCAGGAGGCAGAGGG - Intronic
1033258847 7:139824910-139824932 ATTTGAACCCAGGAGGCAGAGGG - Intronic
1033563595 7:142557774-142557796 CTAGGGAACCAGGAGGAAAACGG - Intergenic
1036744928 8:11400061-11400083 AGGTGGCACAAGGAGGAAGGAGG + Intronic
1036917812 8:12821551-12821573 ATGGGGAACTATGAGGGAGATGG + Intergenic
1037786614 8:21907093-21907115 ATGTGGAACACAGAGAAAGAGGG - Intergenic
1038238510 8:25785308-25785330 ATTTGGATCCTGGAGGAGGAAGG + Intergenic
1038249513 8:25890124-25890146 TTCTGGAACCAGCAGGCAGATGG - Intronic
1038592833 8:28856237-28856259 ATATGGAGCAGGGAGGAAGAGGG + Intronic
1039088763 8:33806028-33806050 GAGTGGGACAAGGAGGAAGAGGG - Intergenic
1039355991 8:36816245-36816267 ATGTGTTCCCAGGAGGAAAATGG + Intronic
1039410626 8:37352286-37352308 ATGTGGCTCCAGGAGGAGGAGGG + Intergenic
1039541954 8:38380613-38380635 GTTTGCAACCAGAAGGAAGAGGG + Intronic
1040443900 8:47473804-47473826 GTGAGGAACCAGGAGGAGGATGG + Intronic
1041025326 8:53679657-53679679 ATGTGGAGCCAACAGAAAGAAGG + Intergenic
1041916757 8:63146271-63146293 AGGTGGAATCAGGAGGAGGAGGG + Intergenic
1041951057 8:63502746-63502768 ATGTGGAAGCAGGAGTTACATGG - Intergenic
1042390889 8:68232173-68232195 GAGGGGAACCAGGATGAAGAAGG + Exonic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1043499205 8:80836438-80836460 ATGGGGAATGAGGAGGGAGAGGG - Intronic
1045511402 8:102814588-102814610 TGGAGGAGCCAGGAGGAAGAAGG - Intergenic
1046277442 8:111982237-111982259 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1046457550 8:114486714-114486736 ATGTGGAACAAAGCTGAAGATGG - Intergenic
1047351156 8:124075863-124075885 ATGCCGGACCAGGAGGCAGAAGG - Intronic
1047586521 8:126279690-126279712 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
1047682072 8:127264510-127264532 TGGTGGGAGCAGGAGGAAGAGGG + Intergenic
1047866478 8:129029492-129029514 ACGGGGAAGAAGGAGGAAGAAGG - Intergenic
1048860451 8:138720772-138720794 AGGGAGAACCAGGAGAAAGAGGG - Exonic
1049101145 8:140579964-140579986 AAGACGAACAAGGAGGAAGAGGG + Intronic
1049346332 8:142141076-142141098 AAGAGGAAGCAGGAGGGAGAAGG - Intergenic
1049418694 8:142507286-142507308 CTGTGGAGCCAGGAGGACGGAGG + Intronic
1049733292 8:144190144-144190166 ATGCAGAGGCAGGAGGAAGATGG - Intronic
1050298891 9:4236426-4236448 ATGTGGAAAAGGGAGGAAAAGGG - Intronic
1051447811 9:17159668-17159690 AACTGGGAACAGGAGGAAGAGGG + Intronic
1051585523 9:18722897-18722919 ATGTGGAACCAGGTGGGGCAGGG - Intronic
1052333877 9:27300022-27300044 AAGTTGTTCCAGGAGGAAGATGG + Intergenic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052859355 9:33427342-33427364 ATGTGGACCCAGGAGGGAGGAGG - Intergenic
1052974298 9:34400346-34400368 ATGGGGCAAGAGGAGGAAGAAGG + Exonic
1053264395 9:36700074-36700096 ATGTGGTGGCAGGAGGAAGGTGG + Intergenic
1053750017 9:41243742-41243764 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1053789815 9:41679197-41679219 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1054155325 9:61635559-61635581 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1054178155 9:61890887-61890909 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1054255516 9:62808080-62808102 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1054335789 9:63807528-63807550 ATGGAGAACCAGGAGAAAGAAGG + Intergenic
1054475114 9:65566667-65566689 ATGTGGATGCAGGTGGACGAAGG - Intergenic
1054659374 9:67689937-67689959 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1055321260 9:75085657-75085679 TTCAGGAACCAGGAGTAAGATGG + Intronic
1055467813 9:76582837-76582859 ATGTGGAACCAGGTATAGGAAGG + Intergenic
1055486775 9:76763796-76763818 ATGGGGAAGCATGGGGAAGAGGG + Intronic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056453017 9:86734838-86734860 ATGTTGCCCCAGCAGGAAGAGGG - Intergenic
1056608017 9:88103364-88103386 ATGAGGAAAGAGGAGGAAGATGG - Intergenic
1056651418 9:88467580-88467602 ATGAACAACAAGGAGGAAGATGG + Intronic
1056818313 9:89817661-89817683 ATGTGGAAACAGAAGGAAGGAGG + Intergenic
1056995251 9:91451147-91451169 ATTTGGAATCAGGAGTAAGAAGG - Intergenic
1057353825 9:94319728-94319750 ACCTGGAAACAGAAGGAAGAAGG + Exonic
1057505591 9:95631005-95631027 ACATGGAACCAGGAGATAGATGG - Intergenic
1057653926 9:96937864-96937886 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1059072479 9:111153014-111153036 AGGAGGAAGGAGGAGGAAGAAGG + Intergenic
1062033095 9:134370940-134370962 AGGTGGAACCCAGTGGAAGAAGG - Intronic
1062343118 9:136102513-136102535 AGGTGGAACCCGGAGGAATGAGG + Intergenic
1062731374 9:138112065-138112087 ATGAGGATTTAGGAGGAAGATGG - Intronic
1203372045 Un_KI270442v1:316499-316521 ATGGAGAACCACGAGAAAGAAGG + Intergenic
1203375716 Un_KI270442v1:374937-374959 ATGGAGAACCAGGAGAAAGAAGG + Intergenic
1186115178 X:6297800-6297822 ATGTGGAAACAGAACGAGGAAGG + Intergenic
1186624968 X:11283659-11283681 ATGTGGAACAGGGAGGCAGAAGG + Intronic
1187311107 X:18143744-18143766 GTGTGGAACCAGGGGAAATATGG + Intergenic
1187699371 X:21950272-21950294 ATGTGGAATTTTGAGGAAGATGG + Intronic
1189058777 X:37729246-37729268 ATGGGGAGGCAGGAGTAAGATGG - Exonic
1189066591 X:37816347-37816369 ATGTGGATCCAGGGAGAAGTCGG - Intronic
1189492657 X:41482024-41482046 ATGTGGAGCCAGGGCAAAGAAGG - Intergenic
1190828510 X:54040520-54040542 AATGGGAACCAAGAGGAAGAAGG + Intronic
1191006218 X:55714100-55714122 AAGAGGAAAAAGGAGGAAGAGGG - Intergenic
1191044244 X:56119241-56119263 AAGTGGGAAAAGGAGGAAGAGGG + Intergenic
1191696279 X:63994071-63994093 TTGAGGAAGCAGGAGGAAAAGGG + Intergenic
1191717169 X:64201729-64201751 AGGTAGAACCAAGAGGGAGAAGG - Intronic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192532846 X:71903969-71903991 ATGTTGACCCAGGATGGAGAAGG + Intergenic
1193102989 X:77636841-77636863 AGGTGGAAGGAGGAGGAAGGAGG + Intronic
1194407037 X:93509361-93509383 AGGAGGAACAAGGAGGAGGAAGG + Intergenic
1194453352 X:94072273-94072295 TGGTGAAACCAGGAGCAAGAGGG - Intergenic
1195028878 X:100907106-100907128 ATTTGGAAGCAAGAGTAAGACGG - Intergenic
1195246764 X:103002138-103002160 ATGTGGACCAAGGAAGATGAAGG - Intergenic
1195289215 X:103414964-103414986 GGGTGGAAGCAGGAGGAAGCTGG - Intergenic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1196117861 X:112016549-112016571 ATGTGGGACCAGGAAGAGAAAGG - Intronic
1196395551 X:115258160-115258182 ATGTGGTAGCAGCAGAAAGAGGG - Intergenic
1197711872 X:129677574-129677596 CTAAGGAAACAGGAGGAAGAAGG + Intergenic
1198518648 X:137431078-137431100 AGGAAGATCCAGGAGGAAGAAGG - Intergenic
1198820795 X:140646205-140646227 ATGTTGAATGAAGAGGAAGAAGG + Intergenic
1199078384 X:143549565-143549587 ATGAGGAGCCAGGAGGTAGAGGG + Intergenic
1199321870 X:146449073-146449095 GTCTGGAGACAGGAGGAAGATGG - Intergenic
1200883074 Y:8240962-8240984 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic
1200940573 Y:8775978-8776000 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1201066313 Y:10098629-10098651 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1201422824 Y:13818956-13818978 AGGAGGAAGGAGGAGGAAGAAGG - Intergenic
1202111115 Y:21421701-21421723 ATGGGGACCCAGAAGGCAGATGG + Intergenic
1202200009 Y:22336240-22336262 ATGGGGAGCCAGAAGGGAGATGG - Intronic
1202233324 Y:22678768-22678790 ATGGGGAGCCAGAAGGGAGACGG - Intergenic
1202309832 Y:23517390-23517412 ATGGGGAGCCAGAAGGGAGACGG + Intergenic
1202560969 Y:26153203-26153225 ATGGGGAGCCAGAAGGGAGACGG - Intergenic