ID: 916585472

View in Genome Browser
Species Human (GRCh38)
Location 1:166146080-166146102
Sequence AACTTCTACTACCTGTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916585471_916585472 30 Left 916585471 1:166146027-166146049 CCTCTCACAGCTACTGTGAGGAG 0: 1
1: 0
2: 1
3: 22
4: 214
Right 916585472 1:166146080-166146102 AACTTCTACTACCTGTATGAAGG 0: 1
1: 0
2: 0
3: 3
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916585472 Original CRISPR AACTTCTACTACCTGTATGA AGG Intronic
900778832 1:4604030-4604052 AACTTCTATTACCTGGTGGACGG - Intergenic
906955123 1:50367797-50367819 ATCTTCTTCTAGCTGTATTAAGG - Intergenic
908614594 1:65905226-65905248 GACTTCCCCTACCTGTAAGAAGG - Intronic
909399052 1:75205604-75205626 ATCATCTAATACCTTTATGAGGG - Exonic
910503361 1:87920464-87920486 TACTTCTATTACCTGTAAAATGG + Intergenic
911085132 1:93970477-93970499 AAATTCTATTGCCAGTATGATGG - Intergenic
911450876 1:98059008-98059030 TATCTCTACTACCTGTATTATGG + Intergenic
916585472 1:166146080-166146102 AACTTCTACTACCTGTATGAAGG + Intronic
917233801 1:172867691-172867713 AACTCCTACTATCTGTCTCAGGG + Intergenic
918096016 1:181334849-181334871 AACTTCTACTCTCAGTAAGATGG - Intergenic
919045768 1:192449825-192449847 ATCATCTACTACCTGCATAAAGG - Intergenic
919279565 1:195470471-195470493 AACTTCTACTACCAATACCAGGG + Intergenic
920839433 1:209541541-209541563 AACTTCAACTAGCTGGATGGAGG + Intergenic
922217823 1:223534951-223534973 AATTACTACTACCTGTATATGGG + Intergenic
1063824030 10:9873865-9873887 TACTTCTAAAACATGTATGATGG - Intergenic
1070868769 10:79729038-79729060 AAGTTCTACTACTTGTAGGTAGG + Intergenic
1072897248 10:99377355-99377377 AACTGCTACTGGCTGTATAAAGG + Intronic
1073242648 10:102068255-102068277 AACTTCTATTTCCTGTAAAATGG - Intergenic
1079865248 11:25725797-25725819 AAATTCTACTAGATGTATAATGG - Intergenic
1085996059 11:81915449-81915471 AACTTCTATTAGTTGAATGATGG + Intergenic
1087258635 11:95985217-95985239 ACCTTCTACTACCTGGGTTAAGG + Intronic
1087877139 11:103371708-103371730 AATTTCTACTTCATGTTTGAAGG - Intronic
1089224056 11:116900718-116900740 AAATATTACTTCCTGTATGAAGG + Intronic
1090725521 11:129522873-129522895 GACTTCTATTATCTGTATGTTGG - Intergenic
1092600196 12:10052510-10052532 AACTTCCACTTTCTGAATGAAGG + Intronic
1093979429 12:25459572-25459594 AACTACTGCTTCTTGTATGAGGG - Intronic
1095126573 12:38485882-38485904 AACTTGAACTACCTGCATAATGG - Intergenic
1100688636 12:97014246-97014268 TACTTTTACCATCTGTATGATGG + Intergenic
1101147486 12:101854862-101854884 AACCTCTACCACATGTCTGAGGG - Intergenic
1104152914 12:126102128-126102150 AATTTCTACTTTCTCTATGAGGG + Intergenic
1104414869 12:128589652-128589674 AACTTCTACTGCCTCTGTGCTGG - Intronic
1118148994 14:63167486-63167508 AACTTCTTGTACCTGGATGCTGG - Intergenic
1120000058 14:79292645-79292667 AACTACTACCATATGTATGAAGG - Intronic
1124137807 15:27050235-27050257 ATATTTTACTTCCTGTATGAAGG + Intronic
1127592619 15:60441217-60441239 AACTTCGAGTATGTGTATGAAGG + Intronic
1137681522 16:50350636-50350658 AACTTCTATCACGTGTATGTGGG + Intronic
1144661104 17:17071558-17071580 AACTTCTGCTTCCTGGACGATGG - Intronic
1149812244 17:59687734-59687756 AACTTCTACTTTCTGTAATAAGG + Intronic
1159595027 18:70374797-70374819 AATTTCTACTTCTTGTATAATGG - Intergenic
1165584948 19:36906521-36906543 CAGTTCTACTAGCAGTATGAAGG - Intronic
925410410 2:3636699-3636721 AACTGCTCCTACCTGTCTGCTGG - Intronic
928990511 2:37228484-37228506 AGCCTCTTCTACCTGGATGAAGG - Exonic
930236107 2:48890233-48890255 AACTTCTACTAACTACATCATGG - Intergenic
932035056 2:68236508-68236530 AAATTCTACTTCCTCTCTGAAGG - Intronic
935077496 2:99759598-99759620 AAATTCTACTAACTACATGAAGG + Intronic
935078386 2:99768726-99768748 AATTTCTTCTTCCTGTTTGAAGG + Intronic
936665657 2:114592295-114592317 ACCTGCTACTTCCTGTTTGATGG + Intronic
937661147 2:124430999-124431021 CAGTTCTCCTATCTGTATGATGG - Intronic
941142398 2:161801480-161801502 AATTAGTACTACCTGTGTGATGG - Intronic
941646120 2:168043108-168043130 ATCTTCAACTACCTGACTGACGG + Intronic
943207986 2:184926229-184926251 TATTTCTCCTACCTGTTTGAAGG + Intronic
943840698 2:192576110-192576132 AACCTCTACTTCCAGTATGATGG - Intergenic
945632918 2:212305471-212305493 TGTTTCTACTACCTATATGATGG + Intronic
1174820533 20:53723031-53723053 TACTTCTACTACTTGTAAGCTGG - Intergenic
1177510691 21:22083509-22083531 AACTTCTAATATCTTTAAGATGG - Intergenic
1178158799 21:29887051-29887073 AACTTATACTAATTGTATGGTGG + Intronic
1178472498 21:32905911-32905933 AAGTTCTACCACCTTCATGATGG + Intergenic
949361957 3:3241961-3241983 CACATCCAGTACCTGTATGATGG + Intergenic
952934185 3:38382728-38382750 AACTGCTTCTCCCTGTATGCTGG - Intronic
956793200 3:72695639-72695661 AACTTCGAAGACCTGTATGCAGG + Intergenic
957901316 3:86496798-86496820 CAGTTCTATTACCTGTATAATGG + Intergenic
958507450 3:94998363-94998385 AACATCAACCACCTGTTTGAGGG - Intergenic
963380414 3:144522995-144523017 ATCTTCTCCTTCCTGTATTATGG + Intergenic
963472007 3:145752382-145752404 AAGTGCTACTACCTGTAACAAGG - Intergenic
963554880 3:146774304-146774326 ATCTTCTACTACATGTATTGTGG + Intergenic
971705215 4:30032927-30032949 AAATCCTCCTACCTCTATGACGG + Intergenic
974268755 4:59621891-59621913 AACTTCTGCTACTTGAAAGATGG + Intergenic
978749170 4:112227858-112227880 AAGTTCTGCTACCTGTAAGCAGG + Intergenic
978930159 4:114301008-114301030 TACTTCTTCTATCTGAATGATGG + Intergenic
982771075 4:159398037-159398059 AACTTCTAGCAGCTGTAAGAGGG + Intergenic
983396051 4:167196980-167197002 ACCTTCTATTACCTTTATCAAGG + Intronic
985560462 5:583563-583585 AGCTTCTACTACCTGCCTGCAGG - Intergenic
986904851 5:12484328-12484350 AACTTCTCCATCCTGTATAATGG - Intergenic
986933056 5:12851555-12851577 AACTTTTTCTACCTGTCTGATGG + Intergenic
988330030 5:29824678-29824700 AACTTCTACAACATGCATCATGG - Intergenic
991769552 5:70027952-70027974 ATCTTTTAATACCTGTATGTGGG + Intronic
991848847 5:70903370-70903392 ATCTTTTAATACCTGTATGTGGG + Intronic
992517304 5:77507865-77507887 AACTCCTACTGCATGTATGCTGG + Intronic
992641218 5:78770025-78770047 AACTTCTGCGACCTGTGTGTGGG + Intergenic
995142140 5:108747201-108747223 AACTTCTCCTGTCTTTATGACGG + Intergenic
997121872 5:131182806-131182828 AACTTCTACTAGGAGTATTAGGG - Intronic
998030365 5:138861607-138861629 AACTTTTATTACAGGTATGAAGG + Intronic
1002566363 5:180114486-180114508 GACATCTACTTCCTGAATGAGGG - Exonic
1003490985 6:6621301-6621323 AACTTTTAATACATGTAAGACGG - Intronic
1004382127 6:15141513-15141535 TACTTGTACTACCTGTCTTATGG - Intergenic
1004683418 6:17918625-17918647 TACTTCTCTTACCTGTAGGAAGG - Intronic
1007504768 6:42327161-42327183 CCCTTCTCCTACCTGGATGAAGG - Intronic
1011547825 6:88500166-88500188 GACTTCTGCTACTTCTATGATGG - Intergenic
1015303978 6:131685423-131685445 AACTTCTTCTACATGTACGAAGG + Exonic
1016392043 6:143584636-143584658 AAGTTCTACTACTTGTTTGTAGG + Intronic
1016829384 6:148418362-148418384 AACTTCTACCACATGTGTCAAGG - Intronic
1020053920 7:5103686-5103708 AACTTCTATTCCCAGTAAGAAGG - Intergenic
1022437521 7:30403914-30403936 GACTTCTACCACCTGTTGGAAGG + Intronic
1022526518 7:31041476-31041498 ACCTTCTATTACCTGCATGTAGG + Intergenic
1028085277 7:86628777-86628799 AACTTCTAGTAGCTGAATAATGG - Intergenic
1028322758 7:89481623-89481645 AACTTGTTCTTCCTGTAGGAAGG + Intergenic
1030337632 7:108343211-108343233 TAATTCTACTGCCTGAATGAGGG - Intronic
1034530657 7:151694480-151694502 ATCTTCTACTTCCTGTATCTGGG + Intronic
1042524687 8:69751880-69751902 AACTTCTACCTCCTCTTTGAAGG + Intronic
1042634938 8:70863835-70863857 AAATTCTAGCACCAGTATGAGGG - Intergenic
1043298134 8:78692663-78692685 AATTGCTGCTACCTGTAGGATGG + Intronic
1044329712 8:90902747-90902769 AATTAGTACTACCTGTAGGAGGG + Intronic
1048421433 8:134282196-134282218 AAATTCTACTTCCTTCATGAAGG - Intergenic
1050135659 9:2461063-2461085 AATGTCTACTACCTGTAGAATGG - Intergenic
1052459472 9:28743926-28743948 TACTTCTGCTACATGTATGTTGG + Intergenic
1054990138 9:71316046-71316068 AACTTCAAGTACCTAAATGATGG + Intronic
1055575699 9:77658618-77658640 AACTTCCATTTCCTGTATCATGG + Intergenic
1055845368 9:80555995-80556017 TATTTCTACTACCTGGGTGATGG + Intergenic
1187111779 X:16309347-16309369 AACTGCTGCTACCAGAATGAAGG - Intergenic
1191595061 X:62934774-62934796 ACCATCTACTACATGGATGAGGG - Intergenic
1192098402 X:68238003-68238025 AACTTCTTCAACCTGATTGATGG - Intronic
1193276264 X:79591347-79591369 AACTTCTATTATGTGTACGATGG - Intergenic
1198008162 X:132520413-132520435 AATTTGTACAACTTGTATGAAGG + Intergenic
1199641957 X:149870991-149871013 TACTTCTACAACATGGATGAAGG - Intergenic