ID: 916586887

View in Genome Browser
Species Human (GRCh38)
Location 1:166156930-166156952
Sequence CTAGGGATTAGGAGCAGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916586878_916586887 13 Left 916586878 1:166156894-166156916 CCCCATAAGGATGTGGCTAGGCT 0: 1
1: 0
2: 0
3: 15
4: 106
Right 916586887 1:166156930-166156952 CTAGGGATTAGGAGCAGCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 153
916586880_916586887 11 Left 916586880 1:166156896-166156918 CCATAAGGATGTGGCTAGGCTGC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 916586887 1:166156930-166156952 CTAGGGATTAGGAGCAGCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 153
916586879_916586887 12 Left 916586879 1:166156895-166156917 CCCATAAGGATGTGGCTAGGCTG 0: 1
1: 0
2: 1
3: 13
4: 101
Right 916586887 1:166156930-166156952 CTAGGGATTAGGAGCAGCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916586887 Original CRISPR CTAGGGATTAGGAGCAGCCA GGG Intronic
901068976 1:6507923-6507945 TTAGGGAATAGGACCATCCATGG + Intronic
903057070 1:20643359-20643381 CACAGGATAAGGAGCAGCCAGGG + Intronic
904280988 1:29418139-29418161 GGAGGGGCTAGGAGCAGCCAAGG - Intergenic
905808799 1:40896889-40896911 CTGGGGACTAGGAGCAGGCCAGG + Intergenic
906112999 1:43337129-43337151 CAAGGGATTAGAGGCAGCCGTGG + Intergenic
906198500 1:43944778-43944800 CCAGGGATGAGGAGGAGCCCTGG + Intergenic
906426946 1:45722955-45722977 CTAGGGTTTAGGAGGAGAGATGG + Intronic
907880929 1:58548708-58548730 CAAGGGCAGAGGAGCAGCCAAGG - Intergenic
911648027 1:100356216-100356238 TGAGGGATTTGGGGCAGCCATGG + Intronic
914227217 1:145730666-145730688 CTAGTGATAAGGAGCAGTTACGG + Intronic
914978226 1:152387134-152387156 GAAGGGGTTAGGAGGAGCCAGGG + Intergenic
915625599 1:157112195-157112217 CTAGGGGTAAGGAGGAGCTAGGG + Intergenic
916056869 1:161074058-161074080 CTAGGGCTGAGGAGGAGCTAAGG - Intronic
916586887 1:166156930-166156952 CTAGGGATTAGGAGCAGCCAGGG + Intronic
916762505 1:167830171-167830193 CAAGAGAATAGGAGCAGCTAGGG - Intronic
920500902 1:206484944-206484966 TGGGGGCTTAGGAGCAGCCAAGG - Intronic
921485224 1:215707522-215707544 CTTGGGAATAGGAACAGCTAAGG + Intronic
922348436 1:224716575-224716597 CTTGGGATTAGCAGCAGGAATGG + Intronic
923842279 1:237686091-237686113 CTAGGGATACAGACCAGCCATGG - Intronic
923962091 1:239097067-239097089 CTAAGGATGAGGAGTTGCCAAGG - Intergenic
1063502163 10:6564673-6564695 CTAGGGATTTGGGTCAGCCTTGG - Intronic
1066246456 10:33588034-33588056 CAAGAGATTAAGAGCAGCCTGGG + Intergenic
1068335342 10:55627686-55627708 GTAGGGATCCCGAGCAGCCACGG + Intronic
1068667165 10:59689243-59689265 CTAGGGAATAGAGGAAGCCACGG - Intronic
1072040801 10:91604360-91604382 CTTGAGATTTGGAGAAGCCACGG - Intergenic
1075727520 10:124618145-124618167 CTAGGGATTGGGGGCAGCAAGGG + Exonic
1075733851 10:124652251-124652273 CCAGGGCTTAGGACTAGCCAGGG + Intronic
1076178556 10:128387425-128387447 CACGTGATTAGGAACAGCCAAGG - Intergenic
1076225899 10:128775195-128775217 CTTGAGATTAGAAGCAGGCAGGG + Intergenic
1078108235 11:8372075-8372097 CTAGGAGTTAGGATCAGCCTGGG - Intergenic
1079854489 11:25584172-25584194 CTAGTGGTTAGGAGCAGACTCGG + Intergenic
1079901849 11:26197107-26197129 CCATGGATGAGGAGGAGCCAGGG - Intergenic
1083173075 11:60934378-60934400 CTGGTGATTAGGAGCCGCCGGGG + Intronic
1083772096 11:64873560-64873582 CTAGGCAATGGGAGCAGCCATGG - Intronic
1084671019 11:70606711-70606733 CTTGGGGTTAGGAGCTGCCCAGG + Intronic
1085217064 11:74842563-74842585 GTAGAGATTAGGAGCAGGGATGG + Exonic
1085482267 11:76832609-76832631 CAAGGGAGTAGGAACAGACATGG - Intergenic
1093960194 12:25264256-25264278 CTATTGATTAGGAGTAGCCTGGG - Intergenic
1097342298 12:58453103-58453125 GTAGGGCTTAGGTCCAGCCATGG + Intergenic
1099950047 12:89291842-89291864 AGAGGGATCAGGAGTAGCCAGGG + Intergenic
1101736278 12:107465658-107465680 CTAGTGATGAAGGGCAGCCACGG - Intronic
1103559023 12:121782623-121782645 CAAGGGGTTAGGAGCAGACATGG - Intronic
1105927287 13:25019047-25019069 ATAGGGCTGAGGAGCCGCCAGGG + Intergenic
1106621865 13:31377979-31378001 CTTGGGAATAGGAACTGCCAAGG + Intergenic
1109730716 13:66409855-66409877 CTAGGGATTTGGGGCAGGGAAGG - Intronic
1113317020 13:109191601-109191623 CTAGGCAAAGGGAGCAGCCAAGG + Intronic
1113990560 14:16024381-16024403 CTAGGGTTTGGGACCAGCCCAGG - Intergenic
1114728875 14:24969277-24969299 CTGGGGATGAGTAGCAGCCAAGG + Intronic
1121448331 14:93992521-93992543 CCAGGGCTGAGGGGCAGCCAGGG - Intergenic
1121905049 14:97732163-97732185 CTGGGGACCAGGGGCAGCCAGGG + Intergenic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1202857949 14_GL000225v1_random:63375-63397 CTGGGCAGTGGGAGCAGCCAGGG - Intergenic
1128479927 15:68028303-68028325 CCAGGGTAAAGGAGCAGCCAGGG + Intergenic
1131016004 15:89058340-89058362 CTAGGTACTAGGAGTGGCCAAGG - Intergenic
1133047975 16:3099698-3099720 CTAGGGCAAAGGAGCAGCGACGG + Intergenic
1135528552 16:23232747-23232769 CTAGGGAGTAGGAGTAGGGAGGG - Intergenic
1136291309 16:29273233-29273255 TTAGGGAGCAGGAGCAGCAAGGG + Intergenic
1140234082 16:73142926-73142948 CTGGGGATTAGGAGCAGCTTTGG - Intronic
1142097177 16:88246699-88246721 TTAGGGAGCAGGAGCAGCAAGGG + Intergenic
1142189561 16:88711706-88711728 CCAGGGACTAGGAGGAGCAATGG - Intronic
1145282660 17:21478878-21478900 CTGGGGATTAGGGGTAGCAACGG + Intergenic
1146873224 17:36388734-36388756 CTGGGGTTAGGGAGCAGCCATGG - Intronic
1148208027 17:45791728-45791750 CTGGGGAGGAGGAGCAGCCCTGG - Intronic
1148524604 17:48319339-48319361 ATAGGGATTGGGACCAGCCTGGG + Intronic
1151653058 17:75481752-75481774 AAAGGGATTTGGGGCAGCCATGG - Intronic
1155594619 18:27470487-27470509 CCAGGGAATAAAAGCAGCCATGG + Intergenic
1156884332 18:42117047-42117069 CTACGGATTATGAGCAGACAAGG + Intergenic
1157059292 18:44268522-44268544 CCAGGGTTTAAGACCAGCCAGGG + Intergenic
1157933915 18:51853355-51853377 CCAGGGAAATGGAGCAGCCACGG + Intergenic
1159172900 18:64796138-64796160 CTGGGGTTTAGTAGGAGCCAGGG - Intergenic
1159959323 18:74543186-74543208 CTATGAATCAGGAGCAGACAGGG + Intronic
1160924166 19:1535148-1535170 CCAGGGAGTAGGAGGTGCCAGGG - Exonic
1163612983 19:18310587-18310609 CGAGGGATTAGCAGGGGCCAGGG + Intronic
1163688557 19:18725887-18725909 CTGGGCAGCAGGAGCAGCCAGGG - Intronic
1164882080 19:31741163-31741185 CTAGAGATGGAGAGCAGCCAAGG - Intergenic
929309844 2:40409966-40409988 CTAGTGAATAGGAGCAACCACGG + Intronic
930996229 2:57721875-57721897 ATAGGGAAAGGGAGCAGCCAGGG - Intergenic
932190935 2:69741469-69741491 GTAGGAGTTAGGAGCAGCCCCGG - Intronic
932419459 2:71592833-71592855 CCAGGGAGAAGGAGCAGCCATGG - Intronic
934113616 2:88764836-88764858 ATAGGGCTGAGGAGCCGCCAGGG - Intergenic
936652647 2:114446797-114446819 CTATGGATTAGAAGTAGCAAGGG - Intronic
941929296 2:170924521-170924543 CTAGGGATAGGGAGAGGCCAGGG + Intergenic
943674424 2:190703232-190703254 CTAGCGATTAGTAGGAGCCACGG + Intergenic
945348251 2:208746161-208746183 CTAGGGATTGGCAGCAGGAATGG + Intronic
946078698 2:217097620-217097642 CAAAGGATTTGGAGCAGGCAGGG - Intergenic
946098660 2:217299627-217299649 CTAGTGTTGAGGAGCTGCCAGGG - Intronic
947497231 2:230646726-230646748 CTAGGGGTTTGGAGAAGCCAGGG + Intergenic
947636308 2:231682342-231682364 CTGGGGATTAGGAAGAGGCAGGG - Intergenic
948373494 2:237505352-237505374 CATGCGATGAGGAGCAGCCAGGG - Intronic
948791240 2:240377949-240377971 CTAGGAGATAGGAGAAGCCATGG + Intergenic
1170962078 20:21034461-21034483 CAAGGGATGAGGAGCAGACAGGG - Intergenic
1171771326 20:29325299-29325321 CTAGGGTTTGGGATCAGCCCAGG + Intergenic
1172620147 20:36313312-36313334 CCAGGGCTTAGTGGCAGCCACGG - Intronic
1172620453 20:36315409-36315431 CTTGGGATGAGGAACAGTCAAGG + Intronic
1173809784 20:45948784-45948806 GTTGGGGTTAGGGGCAGCCATGG - Exonic
1175032942 20:55973518-55973540 CTGGGGAGTGGGAGCAGCCTGGG - Intergenic
1177632596 21:23746648-23746670 CTAGGGACTTGGTCCAGCCATGG - Intergenic
1179233733 21:39527328-39527350 CAAGGGGCTAGGATCAGCCAAGG - Intergenic
1180316710 22:11283145-11283167 CTAGGGTTTGGGACCAGCCCAGG + Intergenic
1180338613 22:11600367-11600389 CTAGGGTTTGGGACCAGCCCGGG - Intergenic
1181660021 22:24339637-24339659 TTAGGGAAGAGGTGCAGCCAGGG - Intronic
1182976735 22:34629221-34629243 CCAGGGATTGGGAGCAACAAAGG - Intergenic
1183649059 22:39144068-39144090 CTAGGGATTGGGAGGCGGCAGGG - Intronic
951345390 3:21542553-21542575 CAAGGGATTGAGAGCAGCCTGGG - Intronic
952388399 3:32859794-32859816 AGAGGGATGGGGAGCAGCCAAGG + Intronic
952909195 3:38167282-38167304 CTAGGGATTGGGAGGAGGCTGGG + Intronic
954315976 3:49802090-49802112 CTAGGCAGAAGGAGCAGCCAGGG - Intergenic
954630237 3:52044068-52044090 CCAGGCATGAGGGGCAGCCATGG + Intergenic
955916182 3:63911437-63911459 CTAGGGATTAGGAGAATATAAGG - Intronic
956467732 3:69535959-69535981 CGAGGCAGCAGGAGCAGCCAAGG - Intronic
963351726 3:144159941-144159963 ATAGAGATTAAAAGCAGCCAAGG - Intergenic
965335894 3:167430635-167430657 AGCGGGATTAGGAGCAGCCTGGG - Intergenic
968535898 4:1129030-1129052 CTAGGGTTTAAGACCAGCCTGGG + Intergenic
972838964 4:42908843-42908865 CCAGGGATTCTGAGTAGCCAGGG + Intronic
976776104 4:88707618-88707640 CTAGGAAATAGGCACAGCCATGG - Exonic
978934035 4:114354267-114354289 CATGAGATTTGGAGCAGCCAGGG - Intergenic
982112334 4:152068193-152068215 CAATGGATTATGAGCAGGCATGG - Intergenic
983775015 4:171595376-171595398 TTAGGGACTAGGAACAGCTACGG - Intergenic
984596022 4:181668796-181668818 CCAGGGAGAAGGAGCAGCAAGGG - Intergenic
985717781 5:1472245-1472267 CTGGGGGTGAGGAGCACCCAGGG + Intronic
986164243 5:5259631-5259653 CAAGGGAAAAGGAGCAGGCAGGG + Intronic
988264255 5:28928594-28928616 ATAGGGCTGAGGAGCTGCCAGGG + Intergenic
990523853 5:56605868-56605890 CCAAGGATTAGAACCAGCCAAGG - Intronic
992154285 5:73939590-73939612 CAATGGAGGAGGAGCAGCCAGGG - Intronic
993042019 5:82825022-82825044 CCAGTGATTAGGACCAGCCGTGG - Intergenic
996587062 5:125101084-125101106 CTGGGGACTAGGAAGAGCCAAGG - Intergenic
998005344 5:138653249-138653271 CTTGGAAACAGGAGCAGCCATGG + Intronic
999833369 5:155341962-155341984 CCAGGAATTTGGAGCAGCCGTGG - Intergenic
1000022033 5:157326572-157326594 CTAGGGTTTAGGTCTAGCCAAGG - Intronic
1001630285 5:173169974-173169996 CAAGGGAGAAGGAGCAGGCAGGG - Intergenic
1006066418 6:31465507-31465529 CTAGTGGTTAGGGGCATCCAGGG - Intergenic
1006704731 6:36009677-36009699 CTAGGGATTAAGAGGAGTTAGGG + Intronic
1011321885 6:86104622-86104644 TTAGGGATTTGGAGCACCCATGG - Intergenic
1011600504 6:89055591-89055613 CCAGGGAGTATGAGAAGCCAAGG + Intergenic
1014396866 6:120934536-120934558 CTATGGCTGAGGAGCATCCATGG - Intergenic
1016048090 6:139501332-139501354 CTAGGGAATAGGGGAAGACAAGG - Intergenic
1017514521 6:155144041-155144063 CAAGGGAAAAGGAGCAGGCAGGG - Intronic
1019491323 7:1314884-1314906 CTAAGGATTAGGAGAAGCTGCGG + Intergenic
1022380084 7:29851449-29851471 CTGGTGAGGAGGAGCAGCCAGGG - Intronic
1023613823 7:41998158-41998180 CTAGGGACTTAGAGGAGCCAGGG + Intronic
1027788723 7:82613010-82613032 ATAGAAATTAGGAGTAGCCAAGG + Intergenic
1028692157 7:93664829-93664851 CTAGGTATTAGGGGAATCCATGG + Intronic
1033583111 7:142754174-142754196 CTAAGGGCCAGGAGCAGCCAAGG + Intronic
1033586129 7:142775647-142775669 CTAAGGGCCAGGAGCAGCCAAGG + Intergenic
1039759806 8:40562360-40562382 CTAGGGATCAGCAGGGGCCAGGG + Intronic
1040007768 8:42634974-42634996 GAAGGTTTTAGGAGCAGCCAGGG - Intergenic
1044714245 8:95086422-95086444 CTAGGGACTGGGTGCTGCCATGG - Intronic
1046368999 8:113275789-113275811 CTGGGGTTTAGGACAAGCCAGGG + Intronic
1046581337 8:116096507-116096529 GAAGGGATTAGGAGCACACAGGG - Intergenic
1048977408 8:139680642-139680664 TCAGGGATTAGGAGCACGCAGGG - Intronic
1049046384 8:140155265-140155287 CTCAGGATTAGGAGCTGCTAAGG + Intronic
1049254876 8:141608500-141608522 CTAGGGACATGGAACAGCCATGG - Intergenic
1049470794 8:142774236-142774258 CTGGGGGTTGGGAGCAGCCTGGG - Intronic
1050593049 9:7179780-7179802 AAAGGGATTAGGAGCAGAGATGG + Intergenic
1053715690 9:40885145-40885167 ATAGGGCTGAGGAGCCGCCAGGG + Intergenic
1054076860 9:60545593-60545615 ATAGGGCTGAGGAGCCGCCAGGG - Intergenic
1055686835 9:78784132-78784154 CTTGGGATCAGGTGCAGCCATGG - Intergenic
1056129248 9:83567282-83567304 CTAGGGACTTGGTGCAGCCTAGG - Intergenic
1058790869 9:108444412-108444434 GTTGGGATTAGGAGCCTCCAGGG + Intergenic
1060358982 9:122936911-122936933 CTGGGGATCAGGATCAGCCTCGG - Intergenic
1061704725 9:132444199-132444221 CTGGGCATTAGCAGCAGCAATGG + Intronic
1185688819 X:2135840-2135862 CAAGGGATTAGAAGCAAACAGGG + Intergenic
1188070305 X:25710224-25710246 TAAGGGATTAGGAGCAGTTAGGG - Intergenic
1188478273 X:30610546-30610568 CTAGAGAATAGGAGCAGGTAGGG - Intergenic
1196143002 X:112285874-112285896 CTAGCGGGTAGGAGCAGGCATGG - Intergenic
1198186382 X:134257589-134257611 CTGGGGACCAGGAGCAGCAAAGG - Intergenic
1200319544 X:155172689-155172711 GTAGGGAAGAGGAGCAGCAATGG - Intergenic
1201073705 Y:10171316-10171338 CTAGGGTTTGGGACCAGCCCAGG - Intergenic