ID: 916592379

View in Genome Browser
Species Human (GRCh38)
Location 1:166204859-166204881
Sequence CAGTGGGAGTTGGGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916592379_916592388 18 Left 916592379 1:166204859-166204881 CCCTCTTCCCCCAACTCCCACTG No data
Right 916592388 1:166204900-166204922 GAATTCCTACCCATCTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916592379 Original CRISPR CAGTGGGAGTTGGGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr