ID: 916593996

View in Genome Browser
Species Human (GRCh38)
Location 1:166224987-166225009
Sequence GCAGCTAGAGAGATAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916593996_916593999 9 Left 916593996 1:166224987-166225009 CCTGCCTCTATCTCTCTAGCTGC No data
Right 916593999 1:166225019-166225041 TTTTGTTTTCATTTCTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916593996 Original CRISPR GCAGCTAGAGAGATAGAGGC AGG (reversed) Intergenic
No off target data available for this crispr