ID: 916597133

View in Genome Browser
Species Human (GRCh38)
Location 1:166254642-166254664
Sequence CATCCCTTCCCCATTGACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916597133_916597135 9 Left 916597133 1:166254642-166254664 CCAAAGTCAATGGGGAAGGGATG No data
Right 916597135 1:166254674-166254696 TTTTATTGGTAAATACAGCAAGG No data
916597133_916597134 -5 Left 916597133 1:166254642-166254664 CCAAAGTCAATGGGGAAGGGATG No data
Right 916597134 1:166254660-166254682 GGATGTGTACTCTATTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916597133 Original CRISPR CATCCCTTCCCCATTGACTT TGG (reversed) Intergenic
No off target data available for this crispr