ID: 916597135

View in Genome Browser
Species Human (GRCh38)
Location 1:166254674-166254696
Sequence TTTTATTGGTAAATACAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916597129_916597135 15 Left 916597129 1:166254636-166254658 CCAAGCCCAAAGTCAATGGGGAA No data
Right 916597135 1:166254674-166254696 TTTTATTGGTAAATACAGCAAGG No data
916597132_916597135 10 Left 916597132 1:166254641-166254663 CCCAAAGTCAATGGGGAAGGGAT No data
Right 916597135 1:166254674-166254696 TTTTATTGGTAAATACAGCAAGG No data
916597133_916597135 9 Left 916597133 1:166254642-166254664 CCAAAGTCAATGGGGAAGGGATG No data
Right 916597135 1:166254674-166254696 TTTTATTGGTAAATACAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916597135 Original CRISPR TTTTATTGGTAAATACAGCA AGG Intergenic
No off target data available for this crispr