ID: 916597295

View in Genome Browser
Species Human (GRCh38)
Location 1:166256925-166256947
Sequence ACCCATGAGCACCTGTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916597295_916597297 -10 Left 916597295 1:166256925-166256947 CCAGGGCACAGGTGCTCATGGGT No data
Right 916597297 1:166256938-166256960 GCTCATGGGTGCTATGGAGCTGG No data
916597295_916597298 -9 Left 916597295 1:166256925-166256947 CCAGGGCACAGGTGCTCATGGGT No data
Right 916597298 1:166256939-166256961 CTCATGGGTGCTATGGAGCTGGG No data
916597295_916597299 5 Left 916597295 1:166256925-166256947 CCAGGGCACAGGTGCTCATGGGT No data
Right 916597299 1:166256953-166256975 GGAGCTGGGTTTCTGAACTCAGG No data
916597295_916597300 6 Left 916597295 1:166256925-166256947 CCAGGGCACAGGTGCTCATGGGT No data
Right 916597300 1:166256954-166256976 GAGCTGGGTTTCTGAACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916597295 Original CRISPR ACCCATGAGCACCTGTGCCC TGG (reversed) Intergenic
No off target data available for this crispr