ID: 916597297

View in Genome Browser
Species Human (GRCh38)
Location 1:166256938-166256960
Sequence GCTCATGGGTGCTATGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916597295_916597297 -10 Left 916597295 1:166256925-166256947 CCAGGGCACAGGTGCTCATGGGT No data
Right 916597297 1:166256938-166256960 GCTCATGGGTGCTATGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916597297 Original CRISPR GCTCATGGGTGCTATGGAGC TGG Intergenic
No off target data available for this crispr