ID: 916597300

View in Genome Browser
Species Human (GRCh38)
Location 1:166256954-166256976
Sequence GAGCTGGGTTTCTGAACTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916597295_916597300 6 Left 916597295 1:166256925-166256947 CCAGGGCACAGGTGCTCATGGGT No data
Right 916597300 1:166256954-166256976 GAGCTGGGTTTCTGAACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916597300 Original CRISPR GAGCTGGGTTTCTGAACTCA GGG Intergenic
No off target data available for this crispr