ID: 916598718

View in Genome Browser
Species Human (GRCh38)
Location 1:166271882-166271904
Sequence CTGTAACCTCAGATGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916598714_916598718 0 Left 916598714 1:166271859-166271881 CCTCATAGACAGCTATCTTCCCG No data
Right 916598718 1:166271882-166271904 CTGTAACCTCAGATGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916598718 Original CRISPR CTGTAACCTCAGATGGCAGA AGG Intergenic
No off target data available for this crispr