ID: 916600402

View in Genome Browser
Species Human (GRCh38)
Location 1:166287767-166287789
Sequence TTCTTGCTTCCTTTCAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916600398_916600402 4 Left 916600398 1:166287740-166287762 CCCTGAAGCAGCTGTGTGTTGTA No data
Right 916600402 1:166287767-166287789 TTCTTGCTTCCTTTCAAGGGTGG No data
916600397_916600402 10 Left 916600397 1:166287734-166287756 CCATGACCCTGAAGCAGCTGTGT No data
Right 916600402 1:166287767-166287789 TTCTTGCTTCCTTTCAAGGGTGG No data
916600399_916600402 3 Left 916600399 1:166287741-166287763 CCTGAAGCAGCTGTGTGTTGTAG No data
Right 916600402 1:166287767-166287789 TTCTTGCTTCCTTTCAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916600402 Original CRISPR TTCTTGCTTCCTTTCAAGGG TGG Intergenic
No off target data available for this crispr