ID: 916600717

View in Genome Browser
Species Human (GRCh38)
Location 1:166290719-166290741
Sequence ATGTGAAAGGGGAAGGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916600709_916600717 -4 Left 916600709 1:166290700-166290722 CCTGTGGAGAGCTCCATGGATGT No data
Right 916600717 1:166290719-166290741 ATGTGAAAGGGGAAGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916600717 Original CRISPR ATGTGAAAGGGGAAGGGGTC TGG Intergenic
No off target data available for this crispr