ID: 916606053

View in Genome Browser
Species Human (GRCh38)
Location 1:166343296-166343318
Sequence GCCGGCTGGCCTGCAAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916606053_916606068 28 Left 916606053 1:166343296-166343318 CCGGGGCTTGCAGGCCAGCCGGC No data
Right 916606068 1:166343347-166343369 CGCCCACCTGCAACTCGGGCTGG No data
916606053_916606066 24 Left 916606053 1:166343296-166343318 CCGGGGCTTGCAGGCCAGCCGGC No data
Right 916606066 1:166343343-166343365 CCCACGCCCACCTGCAACTCGGG No data
916606053_916606057 -7 Left 916606053 1:166343296-166343318 CCGGGGCTTGCAGGCCAGCCGGC No data
Right 916606057 1:166343312-166343334 AGCCGGCCCCTCCGAGTGCGGGG No data
916606053_916606056 -8 Left 916606053 1:166343296-166343318 CCGGGGCTTGCAGGCCAGCCGGC No data
Right 916606056 1:166343311-166343333 CAGCCGGCCCCTCCGAGTGCGGG No data
916606053_916606064 23 Left 916606053 1:166343296-166343318 CCGGGGCTTGCAGGCCAGCCGGC No data
Right 916606064 1:166343342-166343364 GCCCACGCCCACCTGCAACTCGG No data
916606053_916606055 -9 Left 916606053 1:166343296-166343318 CCGGGGCTTGCAGGCCAGCCGGC No data
Right 916606055 1:166343310-166343332 CCAGCCGGCCCCTCCGAGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916606053 Original CRISPR GCCGGCTGGCCTGCAAGCCC CGG (reversed) Intergenic
No off target data available for this crispr