ID: 916616448 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:166446235-166446257 |
| Sequence | TGATTGGGTTCAGATGAAGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 916616448_916616459 | 29 | Left | 916616448 | 1:166446235-166446257 | CCACCTTCATCTGAACCCAATCA | No data | ||
| Right | 916616459 | 1:166446287-166446309 | TATCTAAATATCATCACATTTGG | No data | ||||
| 916616448_916616460 | 30 | Left | 916616448 | 1:166446235-166446257 | CCACCTTCATCTGAACCCAATCA | No data | ||
| Right | 916616460 | 1:166446288-166446310 | ATCTAAATATCATCACATTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 916616448 | Original CRISPR | TGATTGGGTTCAGATGAAGG TGG (reversed) | Intergenic | ||