ID: 916616448

View in Genome Browser
Species Human (GRCh38)
Location 1:166446235-166446257
Sequence TGATTGGGTTCAGATGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916616448_916616459 29 Left 916616448 1:166446235-166446257 CCACCTTCATCTGAACCCAATCA No data
Right 916616459 1:166446287-166446309 TATCTAAATATCATCACATTTGG No data
916616448_916616460 30 Left 916616448 1:166446235-166446257 CCACCTTCATCTGAACCCAATCA No data
Right 916616460 1:166446288-166446310 ATCTAAATATCATCACATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916616448 Original CRISPR TGATTGGGTTCAGATGAAGG TGG (reversed) Intergenic