ID: 916616449

View in Genome Browser
Species Human (GRCh38)
Location 1:166446238-166446260
Sequence AGATGATTGGGTTCAGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916616449_916616460 27 Left 916616449 1:166446238-166446260 CCTTCATCTGAACCCAATCATCT No data
Right 916616460 1:166446288-166446310 ATCTAAATATCATCACATTTGGG No data
916616449_916616459 26 Left 916616449 1:166446238-166446260 CCTTCATCTGAACCCAATCATCT No data
Right 916616459 1:166446287-166446309 TATCTAAATATCATCACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916616449 Original CRISPR AGATGATTGGGTTCAGATGA AGG (reversed) Intergenic