ID: 916616450 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:166446250-166446272 |
| Sequence | GATATTGGGATAAGATGATT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 916616450_916616459 | 14 | Left | 916616450 | 1:166446250-166446272 | CCCAATCATCTTATCCCAATATC | No data | ||
| Right | 916616459 | 1:166446287-166446309 | TATCTAAATATCATCACATTTGG | No data | ||||
| 916616450_916616460 | 15 | Left | 916616450 | 1:166446250-166446272 | CCCAATCATCTTATCCCAATATC | No data | ||
| Right | 916616460 | 1:166446288-166446310 | ATCTAAATATCATCACATTTGGG | No data | ||||
| 916616450_916616462 | 22 | Left | 916616450 | 1:166446250-166446272 | CCCAATCATCTTATCCCAATATC | No data | ||
| Right | 916616462 | 1:166446295-166446317 | TATCATCACATTTGGGATTAGGG | No data | ||||
| 916616450_916616461 | 21 | Left | 916616450 | 1:166446250-166446272 | CCCAATCATCTTATCCCAATATC | No data | ||
| Right | 916616461 | 1:166446294-166446316 | ATATCATCACATTTGGGATTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 916616450 | Original CRISPR | GATATTGGGATAAGATGATT GGG (reversed) | Intergenic | ||