ID: 916616450

View in Genome Browser
Species Human (GRCh38)
Location 1:166446250-166446272
Sequence GATATTGGGATAAGATGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916616450_916616459 14 Left 916616450 1:166446250-166446272 CCCAATCATCTTATCCCAATATC No data
Right 916616459 1:166446287-166446309 TATCTAAATATCATCACATTTGG No data
916616450_916616460 15 Left 916616450 1:166446250-166446272 CCCAATCATCTTATCCCAATATC No data
Right 916616460 1:166446288-166446310 ATCTAAATATCATCACATTTGGG No data
916616450_916616462 22 Left 916616450 1:166446250-166446272 CCCAATCATCTTATCCCAATATC No data
Right 916616462 1:166446295-166446317 TATCATCACATTTGGGATTAGGG No data
916616450_916616461 21 Left 916616450 1:166446250-166446272 CCCAATCATCTTATCCCAATATC No data
Right 916616461 1:166446294-166446316 ATATCATCACATTTGGGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916616450 Original CRISPR GATATTGGGATAAGATGATT GGG (reversed) Intergenic