ID: 916616452

View in Genome Browser
Species Human (GRCh38)
Location 1:166446264-166446286
Sequence CGGGGCTTTTGGGAGATATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916616452_916616462 8 Left 916616452 1:166446264-166446286 CCCAATATCTCCCAAAAGCCCCG No data
Right 916616462 1:166446295-166446317 TATCATCACATTTGGGATTAGGG No data
916616452_916616461 7 Left 916616452 1:166446264-166446286 CCCAATATCTCCCAAAAGCCCCG No data
Right 916616461 1:166446294-166446316 ATATCATCACATTTGGGATTAGG No data
916616452_916616463 30 Left 916616452 1:166446264-166446286 CCCAATATCTCCCAAAAGCCCCG No data
Right 916616463 1:166446317-166446339 GCTTCAAAACATGATTCTTGAGG No data
916616452_916616459 0 Left 916616452 1:166446264-166446286 CCCAATATCTCCCAAAAGCCCCG No data
Right 916616459 1:166446287-166446309 TATCTAAATATCATCACATTTGG No data
916616452_916616460 1 Left 916616452 1:166446264-166446286 CCCAATATCTCCCAAAAGCCCCG No data
Right 916616460 1:166446288-166446310 ATCTAAATATCATCACATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916616452 Original CRISPR CGGGGCTTTTGGGAGATATT GGG (reversed) Intergenic
No off target data available for this crispr