ID: 916616453

View in Genome Browser
Species Human (GRCh38)
Location 1:166446265-166446287
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916616453_916616463 29 Left 916616453 1:166446265-166446287 CCAATATCTCCCAAAAGCCCCGT No data
Right 916616463 1:166446317-166446339 GCTTCAAAACATGATTCTTGAGG No data
916616453_916616460 0 Left 916616453 1:166446265-166446287 CCAATATCTCCCAAAAGCCCCGT No data
Right 916616460 1:166446288-166446310 ATCTAAATATCATCACATTTGGG No data
916616453_916616461 6 Left 916616453 1:166446265-166446287 CCAATATCTCCCAAAAGCCCCGT No data
Right 916616461 1:166446294-166446316 ATATCATCACATTTGGGATTAGG No data
916616453_916616462 7 Left 916616453 1:166446265-166446287 CCAATATCTCCCAAAAGCCCCGT No data
Right 916616462 1:166446295-166446317 TATCATCACATTTGGGATTAGGG No data
916616453_916616459 -1 Left 916616453 1:166446265-166446287 CCAATATCTCCCAAAAGCCCCGT No data
Right 916616459 1:166446287-166446309 TATCTAAATATCATCACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916616453 Original CRISPR ACGGGGCTTTTGGGAGATAT TGG (reversed) Intergenic