ID: 916616454

View in Genome Browser
Species Human (GRCh38)
Location 1:166446274-166446296
Sequence TATTTAGATACGGGGCTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916616454_916616465 28 Left 916616454 1:166446274-166446296 CCCAAAAGCCCCGTATCTAAATA No data
Right 916616465 1:166446325-166446347 ACATGATTCTTGAGGCAGAAGGG No data
916616454_916616460 -9 Left 916616454 1:166446274-166446296 CCCAAAAGCCCCGTATCTAAATA No data
Right 916616460 1:166446288-166446310 ATCTAAATATCATCACATTTGGG No data
916616454_916616463 20 Left 916616454 1:166446274-166446296 CCCAAAAGCCCCGTATCTAAATA No data
Right 916616463 1:166446317-166446339 GCTTCAAAACATGATTCTTGAGG No data
916616454_916616462 -2 Left 916616454 1:166446274-166446296 CCCAAAAGCCCCGTATCTAAATA No data
Right 916616462 1:166446295-166446317 TATCATCACATTTGGGATTAGGG No data
916616454_916616459 -10 Left 916616454 1:166446274-166446296 CCCAAAAGCCCCGTATCTAAATA No data
Right 916616459 1:166446287-166446309 TATCTAAATATCATCACATTTGG No data
916616454_916616461 -3 Left 916616454 1:166446274-166446296 CCCAAAAGCCCCGTATCTAAATA No data
Right 916616461 1:166446294-166446316 ATATCATCACATTTGGGATTAGG No data
916616454_916616464 27 Left 916616454 1:166446274-166446296 CCCAAAAGCCCCGTATCTAAATA No data
Right 916616464 1:166446324-166446346 AACATGATTCTTGAGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916616454 Original CRISPR TATTTAGATACGGGGCTTTT GGG (reversed) Intergenic