ID: 916616455

View in Genome Browser
Species Human (GRCh38)
Location 1:166446275-166446297
Sequence ATATTTAGATACGGGGCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916616455_916616460 -10 Left 916616455 1:166446275-166446297 CCAAAAGCCCCGTATCTAAATAT No data
Right 916616460 1:166446288-166446310 ATCTAAATATCATCACATTTGGG No data
916616455_916616463 19 Left 916616455 1:166446275-166446297 CCAAAAGCCCCGTATCTAAATAT No data
Right 916616463 1:166446317-166446339 GCTTCAAAACATGATTCTTGAGG No data
916616455_916616466 30 Left 916616455 1:166446275-166446297 CCAAAAGCCCCGTATCTAAATAT No data
Right 916616466 1:166446328-166446350 TGATTCTTGAGGCAGAAGGGAGG No data
916616455_916616462 -3 Left 916616455 1:166446275-166446297 CCAAAAGCCCCGTATCTAAATAT No data
Right 916616462 1:166446295-166446317 TATCATCACATTTGGGATTAGGG No data
916616455_916616464 26 Left 916616455 1:166446275-166446297 CCAAAAGCCCCGTATCTAAATAT No data
Right 916616464 1:166446324-166446346 AACATGATTCTTGAGGCAGAAGG No data
916616455_916616461 -4 Left 916616455 1:166446275-166446297 CCAAAAGCCCCGTATCTAAATAT No data
Right 916616461 1:166446294-166446316 ATATCATCACATTTGGGATTAGG No data
916616455_916616465 27 Left 916616455 1:166446275-166446297 CCAAAAGCCCCGTATCTAAATAT No data
Right 916616465 1:166446325-166446347 ACATGATTCTTGAGGCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916616455 Original CRISPR ATATTTAGATACGGGGCTTT TGG (reversed) Intergenic