ID: 916616456

View in Genome Browser
Species Human (GRCh38)
Location 1:166446282-166446304
Sequence TGTGATGATATTTAGATACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916616456_916616464 19 Left 916616456 1:166446282-166446304 CCCCGTATCTAAATATCATCACA No data
Right 916616464 1:166446324-166446346 AACATGATTCTTGAGGCAGAAGG No data
916616456_916616467 28 Left 916616456 1:166446282-166446304 CCCCGTATCTAAATATCATCACA No data
Right 916616467 1:166446333-166446355 CTTGAGGCAGAAGGGAGGAGTGG No data
916616456_916616462 -10 Left 916616456 1:166446282-166446304 CCCCGTATCTAAATATCATCACA No data
Right 916616462 1:166446295-166446317 TATCATCACATTTGGGATTAGGG No data
916616456_916616466 23 Left 916616456 1:166446282-166446304 CCCCGTATCTAAATATCATCACA No data
Right 916616466 1:166446328-166446350 TGATTCTTGAGGCAGAAGGGAGG No data
916616456_916616463 12 Left 916616456 1:166446282-166446304 CCCCGTATCTAAATATCATCACA No data
Right 916616463 1:166446317-166446339 GCTTCAAAACATGATTCTTGAGG No data
916616456_916616465 20 Left 916616456 1:166446282-166446304 CCCCGTATCTAAATATCATCACA No data
Right 916616465 1:166446325-166446347 ACATGATTCTTGAGGCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916616456 Original CRISPR TGTGATGATATTTAGATACG GGG (reversed) Intergenic