ID: 916616460

View in Genome Browser
Species Human (GRCh38)
Location 1:166446288-166446310
Sequence ATCTAAATATCATCACATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916616451_916616460 14 Left 916616451 1:166446251-166446273 CCAATCATCTTATCCCAATATCT No data
Right 916616460 1:166446288-166446310 ATCTAAATATCATCACATTTGGG No data
916616448_916616460 30 Left 916616448 1:166446235-166446257 CCACCTTCATCTGAACCCAATCA No data
Right 916616460 1:166446288-166446310 ATCTAAATATCATCACATTTGGG No data
916616453_916616460 0 Left 916616453 1:166446265-166446287 CCAATATCTCCCAAAAGCCCCGT No data
Right 916616460 1:166446288-166446310 ATCTAAATATCATCACATTTGGG No data
916616450_916616460 15 Left 916616450 1:166446250-166446272 CCCAATCATCTTATCCCAATATC No data
Right 916616460 1:166446288-166446310 ATCTAAATATCATCACATTTGGG No data
916616452_916616460 1 Left 916616452 1:166446264-166446286 CCCAATATCTCCCAAAAGCCCCG No data
Right 916616460 1:166446288-166446310 ATCTAAATATCATCACATTTGGG No data
916616454_916616460 -9 Left 916616454 1:166446274-166446296 CCCAAAAGCCCCGTATCTAAATA No data
Right 916616460 1:166446288-166446310 ATCTAAATATCATCACATTTGGG No data
916616449_916616460 27 Left 916616449 1:166446238-166446260 CCTTCATCTGAACCCAATCATCT No data
Right 916616460 1:166446288-166446310 ATCTAAATATCATCACATTTGGG No data
916616455_916616460 -10 Left 916616455 1:166446275-166446297 CCAAAAGCCCCGTATCTAAATAT No data
Right 916616460 1:166446288-166446310 ATCTAAATATCATCACATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916616460 Original CRISPR ATCTAAATATCATCACATTT GGG Intergenic