ID: 916616461

View in Genome Browser
Species Human (GRCh38)
Location 1:166446294-166446316
Sequence ATATCATCACATTTGGGATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916616453_916616461 6 Left 916616453 1:166446265-166446287 CCAATATCTCCCAAAAGCCCCGT No data
Right 916616461 1:166446294-166446316 ATATCATCACATTTGGGATTAGG No data
916616454_916616461 -3 Left 916616454 1:166446274-166446296 CCCAAAAGCCCCGTATCTAAATA No data
Right 916616461 1:166446294-166446316 ATATCATCACATTTGGGATTAGG No data
916616450_916616461 21 Left 916616450 1:166446250-166446272 CCCAATCATCTTATCCCAATATC No data
Right 916616461 1:166446294-166446316 ATATCATCACATTTGGGATTAGG No data
916616455_916616461 -4 Left 916616455 1:166446275-166446297 CCAAAAGCCCCGTATCTAAATAT No data
Right 916616461 1:166446294-166446316 ATATCATCACATTTGGGATTAGG No data
916616452_916616461 7 Left 916616452 1:166446264-166446286 CCCAATATCTCCCAAAAGCCCCG No data
Right 916616461 1:166446294-166446316 ATATCATCACATTTGGGATTAGG No data
916616451_916616461 20 Left 916616451 1:166446251-166446273 CCAATCATCTTATCCCAATATCT No data
Right 916616461 1:166446294-166446316 ATATCATCACATTTGGGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916616461 Original CRISPR ATATCATCACATTTGGGATT AGG Intergenic