ID: 916616462

View in Genome Browser
Species Human (GRCh38)
Location 1:166446295-166446317
Sequence TATCATCACATTTGGGATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916616450_916616462 22 Left 916616450 1:166446250-166446272 CCCAATCATCTTATCCCAATATC No data
Right 916616462 1:166446295-166446317 TATCATCACATTTGGGATTAGGG No data
916616454_916616462 -2 Left 916616454 1:166446274-166446296 CCCAAAAGCCCCGTATCTAAATA No data
Right 916616462 1:166446295-166446317 TATCATCACATTTGGGATTAGGG No data
916616453_916616462 7 Left 916616453 1:166446265-166446287 CCAATATCTCCCAAAAGCCCCGT No data
Right 916616462 1:166446295-166446317 TATCATCACATTTGGGATTAGGG No data
916616451_916616462 21 Left 916616451 1:166446251-166446273 CCAATCATCTTATCCCAATATCT No data
Right 916616462 1:166446295-166446317 TATCATCACATTTGGGATTAGGG No data
916616452_916616462 8 Left 916616452 1:166446264-166446286 CCCAATATCTCCCAAAAGCCCCG No data
Right 916616462 1:166446295-166446317 TATCATCACATTTGGGATTAGGG No data
916616455_916616462 -3 Left 916616455 1:166446275-166446297 CCAAAAGCCCCGTATCTAAATAT No data
Right 916616462 1:166446295-166446317 TATCATCACATTTGGGATTAGGG No data
916616456_916616462 -10 Left 916616456 1:166446282-166446304 CCCCGTATCTAAATATCATCACA No data
Right 916616462 1:166446295-166446317 TATCATCACATTTGGGATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916616462 Original CRISPR TATCATCACATTTGGGATTA GGG Intergenic