ID: 916616463

View in Genome Browser
Species Human (GRCh38)
Location 1:166446317-166446339
Sequence GCTTCAAAACATGATTCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916616453_916616463 29 Left 916616453 1:166446265-166446287 CCAATATCTCCCAAAAGCCCCGT No data
Right 916616463 1:166446317-166446339 GCTTCAAAACATGATTCTTGAGG No data
916616455_916616463 19 Left 916616455 1:166446275-166446297 CCAAAAGCCCCGTATCTAAATAT No data
Right 916616463 1:166446317-166446339 GCTTCAAAACATGATTCTTGAGG No data
916616456_916616463 12 Left 916616456 1:166446282-166446304 CCCCGTATCTAAATATCATCACA No data
Right 916616463 1:166446317-166446339 GCTTCAAAACATGATTCTTGAGG No data
916616457_916616463 11 Left 916616457 1:166446283-166446305 CCCGTATCTAAATATCATCACAT No data
Right 916616463 1:166446317-166446339 GCTTCAAAACATGATTCTTGAGG No data
916616458_916616463 10 Left 916616458 1:166446284-166446306 CCGTATCTAAATATCATCACATT No data
Right 916616463 1:166446317-166446339 GCTTCAAAACATGATTCTTGAGG No data
916616454_916616463 20 Left 916616454 1:166446274-166446296 CCCAAAAGCCCCGTATCTAAATA No data
Right 916616463 1:166446317-166446339 GCTTCAAAACATGATTCTTGAGG No data
916616452_916616463 30 Left 916616452 1:166446264-166446286 CCCAATATCTCCCAAAAGCCCCG No data
Right 916616463 1:166446317-166446339 GCTTCAAAACATGATTCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916616463 Original CRISPR GCTTCAAAACATGATTCTTG AGG Intergenic