ID: 916628542

View in Genome Browser
Species Human (GRCh38)
Location 1:166586649-166586671
Sequence CTGCTGTTATAGGTTGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916628542_916628544 7 Left 916628542 1:166586649-166586671 CCATTTTCAACCTATAACAGCAG No data
Right 916628544 1:166586679-166586701 CAGTTAAGACAAAGACTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916628542 Original CRISPR CTGCTGTTATAGGTTGAAAA TGG (reversed) Intergenic
No off target data available for this crispr